Intro
This is another of the W.O.O.D. series of semi-regular
Weekly Occasional Open Discussions.
(i.e. if I forget and skip one, no big)
Immediate prior one here:
https://chiefio.wordpress.com/2021/07/03/w-o-o-d-3-july-2021/
and remains open for threads running there (at least until the ‘several month’ auto-close of comments on stale threads).
Canonical list of old ones here:
https://chiefio.wordpress.com/category/w-o-o-d/
“Stuff” Happens
I really like these guy’s “top 10 memes”. They watch what is going on on Gab and Patriot.win and select the ones that they like best. A nice filtering service if nothing else; but the way they match music to the theme is also good. Unfortunately, can’t do an embed that works with my free WordPress plan (it does do free EwTube embeds… but only them) so you get to “hit the link”. This week the theme is “The Revolution Will Not Be Televised” (as they present televised video memes of folks revolting against The Overlords…) It is 19 minutes of fun (if the music isn’t to your taste, you can mute it. Over 95% of the content is visual):
https://rumble.com/vk10wp-top-10-memes-the-revolution-will-not-be-televised.html
Do be prepared to hit pause to pick up the details. Like the lightning in #9 that is “racist” symbol, or text that looks like “ignore me login text” but isn’t ;-) Some of it is subtle and goes by fast…
Rumble — If you enjoy these videos, WatchMaga appreciates your support on Patreon, Subscribestar, or PayPal:
Patreon: https://www.patreon.com/WatchMaga
Subscribestar: https://www.subscribestar.com/watchmaga
Paypal: https://paypal.me/WatchMagaThe occupant of the White House heightens the rhetoric against his adversaries, bringing the country one small step closer to balkanization. In a speech meant to rally opposition to laws passed by state legislatures–laws intended to make elections more secure–Joe Biden condemns much of the country as a new confederacy of ‘insurrectionists.’
ODYSEE: https://odysee.com/@WatchMaga:f
BITCHUTE: https://www.bitchute.com/channel/xQR5ArFlCW3w/
RUMBLE: https://rumble.com/c/c-285381Check out http://www.WhatFinger.com for all the latest MAGA news.
Follow WatchMaga: https://gab.com/WatchMaga
Why include that long list of links and Promotional Text? To illustrate something. Look at it. What do you NOT see? That’s right. Twitter. Facebook. YouTube. All “the usual” Censorship & Oppression sites.
What do you see? Odysee, Bitchute, Rumble, Gab.
What we have here is a clear example of the Big Tech Companies being replaced, for about 1/2 the country at least, with “Alternatives”. I’m now spending about 3/4 or more of my “Video Time” NOT on EwTube (and growing). That’s ad revenue they no longer get. There’s a few things I still watch there, but shrinking daily. Even then, those guys often say something like “For the parts we left out on EwTube, see our Odysee channel”…
I have no idea if the censorship assault has actually reduced total viewing for channels. I do know that for me, I how watch Infowars MORE than before. I’d basically shunned it as I didn’t like the “shouting” aspect of Alex Jones. Then they banned it (even drove it off of the Roku where some Idaho public channel carried it). Now it’s returned at banned.video. I have a link to it on both tablet and desktop. I now check it out about once a week to see what he’s banging on about. They did succeed in making it harder for a couple of months, but created a ‘regular viewer’ (if a lite one) in the process.
Infowars: https://rumble.com/c/c-142211
In essence, the “ban” was at most a bump in the road and has sorted the Censoring Sites into a smaller market. Will it matter? Only time will tell.
Starting with 10 through 8: They poke fun at the “Daily Briefings” at the White House, assert that the Vexxine Door Knockers are in fact just a way to ship funding to the election fraud organizations, point out the George Floyd Mural was destroyed by God (snicker ;-), via RayCist Lightning…, Fauci has a list of 12 and is checking it twice, and the doublespeak from the WH is exposed. Then, there’s a Big One: The White House says it is directing and coordinating the censorship. Direct violation of the 1st Amendment (and more).
At number 7 they show the Paris Protests as a sea of The French say “NON!” to Macron. Unless France uses Dominion voting systems too, I think Marine Le Pen has high odds of being elected next. Look closely at that video segment. FAR more folks maskless than wearing a mask. The French are “Done with this shit” too. I especially like the “My Body My Choice” poster ;-) Note that, while not in the video, the Police later joined the protesters… Just sayin’… Macron might want to review the history of “The French Haircut”…
At #6 they move to South Africa and how it is being destroyed as it embraced Critical Race Theory. As of now, many non-Black neighborhoods have gone to “self policing” to prevent being murdered. One Black government leader states the Blacks were to go into Indian and White neighborhoods and kill people, burn their houses down. So “Note to self: Have enough guns and ammo to stop that.” Note in particular the “Brown on Black” Indians defending their homes against a Black Mob that’s been told to go kill them. Rather like “Rooftop Koreans” being painted as “white racists”…
South Africa is an exemplar of the goal state. Hopefully there’s more folks here seeing through this crap, and early enough to stop it. Note that the major “push” organization for this mess is the ANC, a Marxist organization. Do not ever forget that Marxist Doctrine states they must destroy what is, to bring about the Marxist Communist Socialist Utopia. That there MUST be a destructive “revolution” first. That is the goal state. Does not matter if they are ANC, BLM, DNC or whatever. Method and means are already defined and agreed, globally.
By #5, we’ve moved to Cuba. I had no idea just how huge the protests there were. I also have no idea what has sparked them now. Has Cuba become even more of a hell hole than it was? A minor Dig Here! for later…
Number 4 pokes fun at the Texas Dims who got on a plane without masks (Gee, why was I harassed for 9 hours, in the airport and plane, via automated threats of NEVER being allowed to fly again if I ever was caught maskless?…) and ended up sharing Chinese Wuhan Covid around amongst themselves and the government in D.C. (District Of Criminals).
They then move on to the Election Audits for #2 & #3. Starting to look like a pretty good “roundup of the news” isn’t it? ;-)
Then, at #1, it moves on to the Peaceful Protest at the capitol 1/6. (The “insurrection” has not yet begun…) I especially like the Granny all out of yarn ;-) Biden seems “unclear on the concept” that 620,000 dead in a war lasting years is not the same as one woman murdered by a Government Employee… nor does he ‘get it’ that the Confederates “trying to reach the Capitol” in the Civil War were Democrats…
Normally at this point, I’d do a ‘review of the news’, but frankly, I think that list already pretty much covers it. Bongino report adds some bits, like the DOJ not bothering with Dim Governors nursing home murder by proxy. I probably ought to mention the Defense funding bill that just, incidentally, subjects women to the Draft:
https://nypost.com/2021/07/23/senate-defense-bill-would-require-women-to-register-for-draft/
Senate defense budget bill would require women to register for draft
By Emily JacobsJuly 23, 2021 | 10:45am | UpdatedChanges to the draft, officially known as the Selective Service System, were made official in the National Defense Authorization Act, the annual military budget bill, which the Senate Armed Services Committee announced it had approved Thursday.
The NDAA “amends the Military Selective Service Act to require the registration of women for Selective Service,” a summary of the bill reads.
But hey, if anyone with a “full set” can still just decide to “identify as a woman” I guess you need that to be able to assure you don’t end up with a population 80% “identifying as a woman” during an unpopular war… so there’s that…
Breightbart does a decent job covering the South Africa Marxist civil war:
https://www.breitbart.com/africa/
Africa
Pictures:
Vigilantism Grows in South Africa as Citizens Tackle Unrest ThemselvesBiden Administration Conducts Its First Airstrike in Somalia
Report:
Biden Administration Conducts Its First Airstrike in Somalia
The Pentagon on Tuesday announced the first airstrike in Somalia during the Biden administration.
JOHN HAYWARD21 Jul 2021, 8:43 AM PDT9Report: Fulani Muslim Militants Kill Ten in Attacks on Nigerian Villages
Fulani Muslim raiders killed ten people last week, including an infant, in the Christian-majority southern Kaduna State in Nigeria, the Barnabas Fund reported Monday.
THOMAS D. WILLIAMS, PH.D.20 Jul 2021, 10:01 AM PDT10Delingpole: Boris Plays Climate Fiddle While South Africa Burns
Rioting, looting and violence have swept two South African provinces, Gauteng and KwaZulu-Natal. Dozens of people have been killed, vital infrastructure has been destroyed and the damage runs into the billions. But it’s OK: the Imperial mother country has got South Africa’s back. Behold the latest initiative from the United Kingdom’s Foreign and Commonwealth Office!
JAMES DELINGPOLE18 Jul 2021, 9:40 AM PDT145South Africa: Mother Throws Baby to Safety from Burning High-Rise
A mother in Durban, South Africa, threw her two-year-old daughter off of a high-rise tower Tuesday in an effort to save the toddler’s life after a fire broke out in the building, Reuters reported.
GABRIELLE REYES17 Jul 2021, 10:19 AM PDT355Financier CEO Suspended for Looting Booze and Home Appliances During South Africa Riots
The founder and chief executive officer of a wealth management fund has been suspended for allegedly taking advantage of the unrest in South Africa to loot alcoholic beverages and a washing machine, among other items.
JACK MONTGOMERY16 Jul 2021, 5:09 AM PDT58Pictures: Vigilantism Grows in South Africa as Citizens Tackle Unrest Themselves
Armed community members and vigilante groups have stepped in to tackle unrest in South Africa, taking matters into their own hands.
BREITBART LONDON16 Jul 2021, 4:56 AM PDT607South Africa Calling Up Reserves and Deploying 25,000 Troops as Riots and Looting Continue
he South African government is deploying some 25,000 troops and calling up reserves as riots and looting continue to rock the country, primarily in the provinces of KwaZulu-Natal and Gauteng.
JACK MONTGOMERY16 Jul 2021, 4:25 AM PDT658Blue State Blues: Burning Books in America, Burning Cities in South Africa
The effort to ban Abigail Shrier’s book is a shocking attack on freedom in America — and the chaos of South Africa is where it leads.
JOEL B. POLLAK16 Jul 2021, 12:00 AM PDT246South Africa: Warehouse Ransack Decimates Food Supply for 675,000
FoodForward SA (FFSA), a food supply organization that works to end hunger in South Africa, announced on Thursday it would shut down its operations in five major cities after looters cleaned out their warehouse in Durban.BEN WHEDON15 Jul 2021, 9:32 AM PDT
My take on this is two things:
1) Africa is fully “in play”.
2) Watch South Africa for how the play book is run.
Oh, and just in case you were thinking that Big Tech was interested in STOPPING this kind of violence via censoring “hate speech”, note that they are letting that run. It’s the goal, after all… IMHO of course:
Indians Fear Attack in South Africa as Big Tech Fails to Stop Incitement
South Africans of Indian descent fear mob violence as threats escalate on social media during the ongoing violence and looting, especially in KwaZulu-Natal province, which has a large proportion of residents with roots on the Subcontinent.
JOEL B. POLLAK15 Jul 2021, 5:39 AM PDT
Then, just to round things out: The plague plagued Olympics is started in Tokyo (just in time for a Typhoon to be headed straight at it). If anyone cares anymore:
https://www.foxnews.com/live-news/tokyo-olympics-summer-games-japan
Published July 22, 2021
Last Update 12 min(s) agoLIVE UPDATES: Tokyo 2021 Olympics’ opening ceremonies kick off the Games
Athletes from all over the world will compete in the summer Olympic games, with many COVID-19 rules in place
I’ve got zero interest in watching a bunch of Political Performative Art by folks smothered in masks without an audience. What’s the point?
If anything interesting happens AS SPORTS, I’ll catch the highlight on something where I can fast forward over the crap.
For more, see:
Trump Social Media site:
Bongino Report:
Or Whatfinger:
https://generaldispatch.whatfinger.com/
I’ve also gotten addicted to the Top Ten Memes of the week from WatchMAGA here:
They have interesting “bite” to them, along with a tendency to highlight the news of the week in memes, so good as a social attitude pointer too. Plus they are “way fun” ;-)
Musings from the Chiefio 
This one from May 24th is also seriously good. I especially like the little girl, maybe 6?, telling off what I surmise is the School Board ;-O
https://rumble.com/vhj2nh-top-10-memes-the-kids-are-alright.html
And yes, I’ve started working back through the older ones, and loving it ;-)
https://www.wsj.com/articles/behind-cubas-covid-uprising-11626042703
Mary Anastasia O’Grady
Behind Cuba’s Covid Uprising
Most poor countries put all hands on deck in this crisis. Havana exports its doctors.
A snippet:
. . . the U.S. “routinely authorizes the export of humanitarian goods, agricultural products, medicine, and medical equipment to support the Cuban people.” Ms. Chung further noted that in 2019 the U.S. exported millions of dollars of medical goods to Cuba.
Cuba’s real problem is that it’s broke. {end quote}
Somewhat O/T – An economic view
http://www.smalldeadanimals.com/2021/07/23/y2kyoto-carnel-knowledge/
The word play is on Mark Carney of Canadian, British and other banking
An electric bus manufactured by Proterra caught fire while charging in a southern California city that is now considering taking the electric buses off the road, according to government records.
The Foothill Transit agency, which serves the valleys surrounding Los Angeles, will decide on Friday whether costly Proterra buses purchased in the last decade are still operable. Problems cited by the agency include not only the bus that caught fire in what’s described as a “thermal event,” but also buses that melt in the California heat and have transmission failures. Roland Cordero, the agency’s director of maintenance and vehicle technology, says the problems with the buses are exacerbated by Proterra’s inability to help with repairs.
https://www.thegatewaypundit.com/2021/07/ca-agency-may-scrap-electric-bus-fleet-electric-buses-melt-california-sun-catch-fire-cost-much-fix/
@Another Ian:
On an “open discussion” page, there can be no “off topic” ;-)
@Jim2:
I guess we are reaching that point where EVs are “of a certain age” and will start having dendrite growth Flaming Expiration issues ;-)
Yes, I’m catching up on Redpower Memes and jokes….
Recent Greek Fresco found:
“Israel data: Vaccines only 16% effective after 6 months but still prevent 86% hospitalization”
https://joannenova.com.au/2021/07/israel-data-vaccines-only-16-effective-after-6-months-but-still-prevent-86-hospitalization/
Brave seems to have got very picky lately about the cursor being exactly on the LHS character of a “do anything” and “sometimes” at that
I was pursuing a movie for the last night of Bach’in it here, so thought to share :-)
I get random landscapes as screen savers. Today, it was an image of Phuket Province, Thailand.
It sounds like a pretty laid back place to me.
😜
“The Democrats’ ultimate end game – making our vote meaningless”
https://bayourenaissanceman.blogspot.com/2021/07/the-democrats-ultimate-end-game-making.html
@H.R.:
Now that was sneaky, and a low blow too… But it was Beeching for a while…
Ever thought of moving to Mai Wai?
@Another Ian:
You mean it wasn’t already last election?… Just sayin’… Usurper Biden at the Big Boys Desk (even if he needs a guide to get him to it and fetch his nap-rug…)
@Ossqss:
Convenient. I’m quasi caught up, tired of looking at news, not enough wine in me to want music videos… But an hour+ of a movie and a few more glasses might just do it ;-)
@EM, I have been watching a series lately too. “Designated Survivor” has proven quite entertaining through season 1. Same lead as 24, if that matters for some.
“Modern economics provides no sound advice on how to manage an economy”
https://catallaxyfiles.com/2021/07/24/modern-economics-provides-no-sound-advice-on-how-to-manage-an-economy/
@Ossqss:
Nice reminder of when I saw it some 50 or so years ago… Curiously Appropriate as the Vaxxed Mob comes for the heads of those Unvaxxed but also not sick…
I was surprised at how slowly it seemed to move. Clearly movies have gone from hour long psycho-drama that oh so slowly builds for suspense right into 3000 rounds / per scene and at least a body a minute hacked into parts… I remember it as far more gory that it is now ;-)
Per Designated Survivor: Yeah, I watched a bunch of the episodes. Then “something came up” and I didn’t get back to it. I liked it. Again “Curiously Appropriate” for our times….
@Another Ian:
The way to “manage an economy” is really rather simple. Don’t.
It is a complex beast full of many feedback loops. There is No Way you can “manage it”. Just keep the money sound (which, BTW, is what our Constitution says to do: Gold & Silver only, no paper shit and no creating “currency” out of thin air) and leave folks alone to create businesses that thrive of fail as their lot leads them. That’s ALL.
Pretty simple, really. What we in the USA had up until about 1972 or so (though the regulatory burden was already large by then).
Oh Well. They didn’t ask me. Nobody ever asks me. ;-)
“What climate disaster? The Great Barrier Reef has more coral growing on it than ever recorded
https://joannenova.com.au/2021/07/great-barrier-reef-has-more-coral-growing-on-it-than-ever-recorded/
E.M.
Years ago I read an item on how Switzerland kept a balance between “capitalism” and “socialism”.
It was basically a free hand until one threatened to get ahead, when there was a tilt (or a threat of one) towards the other
“Dangerous New Freedom Variant Causing People To Ignore Government And Live Their Lives”
https://babylonbee.com/news/new-dangerous-freedom-variant-has-people-ignoring-government-edicts
Via SDA
“Czech Senate Approves Amendment Granting Right to Bear Arms in Constitution”
https://www.breitbart.com/europe/2021/07/24/czech-senate-approves-amendment-granting-right-to-bear-arms-in-constitution/
Thanks for the A-10 meme. I love it!
@E.M.S. ‘Love the ‘Recent Greek Fresco’!
Heard on Gutfeld from Tyrus: “Woke Supremacy”
Someone ran a script on the Election Management Server (which I believe it the one with a SQL Server database) such that the Windows event log entries dated around the 2020 election would roll off.
Maricopa County still has not provided answers or complied with the Arizona Senate subpoenas after the earth-shattering hearing last Wednesday.
One of the major concerns presented by audit officials surrounded the administrative account passwords and the missing event logs that were deleted by 37,646 consecutive login queries in one day.
Every election Administrator account, no matter the user, all have the same password.
The system only has 8 users which shows that somebody ran a script with over 37,000 queries and deleted the election security logs prior to February 5th.
The Gateway Pundit reported on these ‘worst in class’ IT actions and deliberate subterfuge of an election system.
We don’t know where the script came from because Maricopa County refuses to comply with Arizona Senate subpoenas.
https://www.thegatewaypundit.com/2021/07/2020-election-security-procedures-violated-county-will-not-provide-routers-splunk-logs-fobs-indict-supervisors/
@Annie & Corsair Red:
Glad to share and nice to know it was to good effect ;-)
@Jim2
What puzzles me is why the Audit side is not anticipating that such crap will be done and outmaneuvering them with force. I.E. why didn’t the Senate just appoint the State Police to go collect the gear “by surprise” as soon as they new they wanted it? Cut the subpoena, hand it to the State Police leader, and say “Bring it back today.”
One side playing to every possible hobbling rule, the other side lawless. And they are surprised at how it turns out?
Well, at least we know that the entire DNC and on down to the county level are all criminals and liars. The Rot is strong in them… Unfortunately, it is continuing to grow and spread.
I’ve wondered about that also, EMS. The Senate has subpoena power, but no policing arm. The policing part may lie in the hands of the RINO administration. Not good for us.
Wait, what?
https://www.cdc.gov/csels/dls/locs/2021/07-21-2021-lab-alert-Changes_CDC_RT-PCR_SARS-CoV-2_Testing_1.html
A link found on Jo Nova’s ‘unthreaded’ post, about which I say nothing:
https://metro.co.uk/2021/07/24/ministers-privately-worried-covid-19-is-spreading-through-farting-14983904/
Thanks, Ossqss. PCR tests, by their nature, cannot do what these people want them to do. That’s why the inventor said that they were not to be used for diagnosis.
@Steve C,
Well, it is possible; but we’d need to know the minimum infectious dose before we could begin to work this out. No one, it seems, has ever published that *important* bit of information.
@ Steve C says: 24 July 2021 at 8:50 pm
Uh oh. Get ready for … wait for it … BUTT MASKS!!!
I do the Top 10 Memes (from Whatfinger) on Bitchute. Whenever someone sends me a link to ewe toob, I DDG it and see if it is on other medium first. Then watch it there. If it is not, I will watch the Ewe Toob about half the time or less. Just not interested enough to enhance their revenue.
Well, looks like the AZ Senate does have one guy with a gun, the Sergeant at Arms. I wonder if he can deputize people if he needs to round up a herd?
“The annual “last chance” announcement.”
https://catallaxyfiles.com/2021/07/25/the-annual-last-chance-announcement/
Steve C
More on that
http://www.smalldeadanimals.com/2021/07/24/my-butts-already-double-masked/
On a less scatological note, I was heartened to come across this today. 1,500-odd Christian clergy in the UK have written an open letter to Boris Johnson expressing opposition to his proposed introduction of so-called “vaccine passports” here. I shall try to visit the (three) churches in Nottingham with a signatory over the next few days, to congratulate the individuals concerned. Whether it actually does anything to slow the juggernaut rolling over us remains to be seen, of course, particularly given that Christianity itself is one of the globalists’ targets.
https://www.theepochtimes.com/mkt_morningbrief/doctors-raise-awareness-on-ivermectin-as-treatment-for-covid-19-to-help-end-the-pandemic_3916366.html
This is the real and most dangerous downside of government supplied medical care – or government supplied anything else, for that matter.
The need for action is laid out in stark terms. Poor diets contribute to around 64,000 deaths every year in England, and the government spends £18 billion a year treating obesity-related conditions. How we grow food accounts for a quarter of greenhouse gas emissions and is the leading cause of biodiversity destruction.
To meet these challenges, the report calls for “escaping the junk food cycle” to improve general health and reduce the strain on the NHS, reducing the gap in good diets between high- and low-income areas, using space more efficiently to grow food so that more land can return to nature, and creating a long-term shift in food culture.
“With Narrative Established, CDC Announces Withdrawal of Rapid Response COVID Test to Belatedly Stop Diagnosing Influenza as SARS-COV-2?”
https://theconservativetreehouse.com/blog/2021/07/25/with-narrative-established-cdc-announces-withdrawal-of-rapid-response-covid-test-to-belatedly-stop-diagnosing-influenza-as-sars-cov-2/
“Saturday Snippet: China, the USA and the “Long Game” ”
https://bayourenaissanceman.blogspot.com/2021/07/saturday-snippet-china-usa-and-long-game.html
@Another Ian:
So “It is worse than we thought” because it wasn’t worse than we thought…
This whole thing is so sketchy and manipulated to some ulterior motive that it makes me mad to think about it.
What I’ve not been able to fully ken is just why. What is the hidden agenda. Just sales of the not-a-vax vexxine? Sterilization of a generation? Killing off 7.5 Billion but gradually via accelerating illnesses? All have been suggested. So far, only increased sales is proven. (Miscarriages after the shot are known in number, but so have been births among the vaccinated I think… Then we’re entering the window where Antibody Dependent Enhancement ought to start showing up, and it has not been, mostly… some indication that vaccinated get “variants” to greater degree, but with lesser damage – so far…)
It quite clearly is a managed “Show”, but just why? To what end? We KNOW it isn’t to improve our health, as they would have just flooded the world with Ivermectin in the first few months when it was shown to work Very Well. (I’ve been using it for over a year now, pushing 1.5 years I think… so it was known way back then ’cause I didn’t think it up…)
Oh Well…
I take solace in knowing that, to the extent the RNA Frankenshot does damage to folks, it will be doing it mostly to those who followed the rules and / or were staunch Dimocrats; enriching the world in Surly Curmudgeons and Republicans who refuse it.
FWIW
“Who Watches The Watchmen? – Fauci’s “Noble Lie” Exposed”
https://www.zerohedge.com/political/who-watches-watchmen-faucis-noble-lie-exposed
EMS – O’Charleys caramel pie. I’ve had a slice and based on my expert (/sarc) taste test, this recipe comports with what I had. I have a caramel pie recipe that is vastly different from this, it being a true custard.
O’Charley’s caramel pie – the actual link:
https://www.food.com/recipe/ocharleys-caramel-pie-72467
“Why Is The CDC Quietly Abandoning The PCR Test For COVID?”
https://www.zerohedge.com/covid-19/why-cdc-quietly-abandoning-pcr-test-covid
“So, in summary, with regard to our current “casedemic”, positive tests as they are counted today do not indicate a “case” of anything. They indicate that viral RNA was found in a nasal swab. It may be enough to make you sick, but according to the New York Times and their experts, probably won’t. And certainly not sufficient replication of the virus to make anyone else sick. But you will be sent home for ten days anyway, even if you never have a sniffle. And this is the number the media breathlessly reports… and is used to fearmonger mask mandates and lockdowns nationwide…”
Via Cat Files
@Jim2:
Now that is a simple recipe! I”m going to give it a try!
@Another Ian:
I’m really annoyed at how fraudulent this whole thing has been. Whereas I started off trusting that the CDC, FDA, etc. were trustworthy and relatively moral; I’m now of the opinion they are completely bought off by someone. Don’t know if it is China, The Drug Majors, The Deep State, or what. Don’t really care too much either. They are just useless to me know. Another garbage bureaucracy doing nothing useful or good and wasting money. Untrustworthy.
The way perfectly reasonable therapeutics were absolutely vilified and caused death by their denial is unforgivable.
“The Other Side of the COVID Vaccination Argument, Video
July 25, 2021 | Sundance | 197 Comments
There is a lot of incoming information from government and the private sector promoting the vaccine. Recently, there has been a significant uptick in compulsory demands for taking the COVID vaccine. This forced vaccination approach has made many people start to question why this coordinated pressure campaign has increased with such ferocity.
As a result of such one-side information, people are increasingly skeptical. In this video below you can review the counter-position for why people do not want to take the vaccination shot. [Direct Link] I am not sure who produced it, but CTH is sharing it in an effort to provide balance. The claims are well cited.”
More at
https://theconservativetreehouse.com/blog/2021/07/25/the-other-side-of-the-covid-vaccination-argument-video/
E.M.Smith says: 25 July 2021 at 10:57 pm “Just sales of the not-a-vax vexxine?”
E.M. it is not just sales of the Vax, it is also the the test kits, the masks etc.
“Then we’re entering the window where Antibody Dependent Enhancement ought to start showing up, and it has not been,”
Watch this video, does the guy at the end let slip the truth?
https://rumble.com/vkba8x-update-from-sydney-all-new-covid-hospitalizations-involve-vaccinated-indivi.html
Does he say Vaccinated, or was it a mistake and he meant to say Unvaccinated?
There is a three part series on the Spitfire on this site. This is Part 3, with links to the first two:-
https://bayourenaissanceman.blogspot.com/2008/03/weekend-wings-13-spitfire-legend-lives.html
Including this bit on a couple of unusual records
“It should also be noted that the Spitfire achieved the highest speed ever attained by a propeller-driven aircraft. In high-speed diving trials conducted at Farnborough in England during late 1943 and 1944 a Spitfire Mark XI achieved a true air speed of 606 mph. Another Spitfire, a Mark XIX, reached an altitude of 51,550 feet in 1951, which is reportedly the highest altitude ever attained by a single-engined propeller-driven aircraft. In descending, this aircraft entered an uncontrollable dive during which it is calculated that a true air speed of no less than 690 mph was achieved. The aircraft landed safely. The Spitfire’s ability to achieve such speeds in a dive was due to its wing, which had a Mach limiting number of 0.9 – the highest of any Allied aircraft in World War II.”
From the FWIW Department …
Coronavirus vaccines lessen the chance of you getting COVID-19 and massively reduce the risk of developing serious illness and being hospitalised. Yet at the same time, most COVID-19 deaths in England are now currently among the vaccinated. Is this a cause for alarm?
Put simply, no, says Kit Yates, senior lecturer in mathematical biology at the University of Bath. No vaccines are 100% protective, so cases, hospitalisations and deaths are still to be somewhat expected among those who’ve been jabbed – and especially in those who are older.
This is because the risk of dying from COVID-19 increases so steeply with age that even being vaccinated doesn’t lower the risk for older people down to levels that some younger people experience. Due to their age, a vaccinated 70-year-old is still at greater risk from COVID-19 than an unvaccinated 35-year-old. Given this, it isn’t surprising that more vaccinated people are dying of COVID-19 than unvaccinated people.
https://theconversation.com/covid-vaccine-weekly-more-vaccinated-than-unvaccinated-britons-are-now-dying-from-the-coronavirus-164526
@jim2 – And where did the queue start for vaccinations? Yep. Oldest first.
The push to vaccinate those under age 18 seems just plain (evil) agenda driven. Totally unnecessary. The masks for kids bugs the snot out of me, too. Masks don’t work and it’s even worse with fidgety, grimy kids. I am of the decently informed opinion that masks on kids is a harmful practice.
Oh, for years it’s always been a pretty routine policy that no visitors under 12 would be allowed in nursing homes and certain hospital wards during flu season. Common sense, since rug rats are pretty much diseased infested vermin (God love ’em!). Parents get exposed to every bug going around when they have kids in school.
No masks on kids until now. Everyone just washed their hands after handling one of the little darlings.
@another ian: The Spitfire! One of my favorite planes. I have a print of a Barry Clark painting of a Spitfire on my office wall.
It’s a tossup for me between the Lockheed Lightning and the Spitfire for absolute favorite. I go back and forth on that.
(Don’t forget that (quite?) a few of the Spitfire pilots were only 18 or 19 years old. Many of those were shot down. Today, our kids have their noses stuck in cell phones.)
Not good …
Rep. Clay Higgins, R-La., announced Sunday night that he and his wife had contracted COVID-19 for the second time, and added it was “far more challenging.”
“I have COVID, Becca has COVID, my son has COVID,” Higgins said in a Facebook post. “Becca and I had COVID before, early on, in January 2020, before the world really knew what it was. So, this is our second experience with the CCP biological attack weaponized virus … and this episode is far more challenging. It has required all of my devoted energy.”
https://www.newsmax.com/newsfront/rep-clay-higgins-covid-second-challenging/2021/07/26/id/1029928/
That’s Barrie A.F. Clark. My bad.
This is something I think we should keep in mind when intaking any information – it may be a plant intended solely to manipulate us. The info could come from a nominally conservative, lefty, or other source. Buyer beware …
Private firms, straddling traditional marketing and the shadow world of geopolitical influence operations, are selling services once conducted principally by intelligence agencies. They sow discord, meddle in elections, seed false narratives and push viral conspiracies, mostly on social media. And they offer clients something precious: deniability. “Disinfo-for-hire actors being employed by government or government-adjacent actors is growing and serious,” said Graham Brookie, director of the Atlantic Council’s Digital Forensic Research Lab, calling it “a boom industry.”
Similar campaigns have been recently found promoting India’s ruling party, Egyptian foreign policy aims and political figures in Bolivia and Venezuela. Mr. Brookie’s organization tracked one operating amid a mayoral race in Serra, a small city in Brazil. An ideologically promiscuous Ukrainian firm boosted several competing political parties. In the Central African Republic, two separate operations flooded social media with dueling pro-French and pro-Russian disinformation. Both powers are vying for influence in the country. A wave of anti-American posts in Iraq, seemingly organic, were tracked to a public relations company that was separately accused of faking anti-government sentiment in Israel.
https://tech.slashdot.org/story/21/07/26/0151246/disinformation-for-hire-is-becoming-a-booming-industry
Combating and preventing today’s threats to enterprises require comprehensive protection focused on addressing the full scope and impact of attacks. Anything that can gain access to machines—even so-called commodity malware—can bring in more dangerous threats. We’ve seen this in banking Trojans serving as entry point for ransomware and hands-on-keyboard attacks. LemonDuck, an actively updated and robust malware that’s primarily known for its botnet and cryptocurrency mining objectives, followed the same trajectory when it adopted more sophisticated behavior and escalated its operations. Today, beyond using resources for its traditional bot and mining activities, LemonDuck steals credentials, removes security controls, spreads via emails, moves laterally, and ultimately drops more tools for human-operated activity.
LemonDuck’s threat to enterprises is also in the fact that it’s a cross-platform threat. It’s one of a few documented bot malware families that targets Linux systems as well as Windows devices. It uses a wide range of spreading mechanisms—phishing emails, exploits, USB devices, brute force, among others—and it has shown that it can quickly take advantage of news, events, or the release of new exploits to run effective campaigns. For example, in 2020, it was observed using COVID-19-themed lures in email attacks. In 2021, it exploited newly patched Exchange Server vulnerabilities to gain access to outdated systems.
https://www.microsoft.com/security/blog/2021/07/22/when-coin-miners-evolve-part-1-exposing-lemonduck-and-lemoncat-modern-mining-malware-infrastructure/
H.R. says: 26 July 2021 at 12:24 pm
My favourite is the De Havilland Mosquito, it literally did just about every aircraft role in the war.
AC Osborn says: 26 July 2021 at 9:14 am
Apparently the Health official made a correction later and reversed the numbers.
I haven’t acually seen it yet.
Another Ian, the height record before WW2 was held by an Italian open-cockpit biplane, the Caproni 161, at 56,047 ft. That record still stands, for a single-engined piston aircraft. Weirdly the record with no engine is 76,000 ft.
@Another Ian, H.R.:
If I had to chose between the Supermarine Spitfire, the Lockheed P-38 Lightning and the De Havilland Mosquito… I don’t think I could!
The P-38 did things with range in the Pacific that just were impossible with other aircraft. But it had early teething problems and is was Lindbergh who figure out how to increase the range dramatically by particular flying behaviours. The Germans called it the twin tailed Devil IIRC, as it a dog fight it also did exotic things ;-) Designed by one of my favorite designers: Kelly Johnson. Designer of several other of my favorites including in much later years the SR-71 Blackbird…
The Spitfire was just amazing in all the jobs it did and how well it did them. A superb wing design and a well balance aircraft that just worked. It was everywhere as the iconic fighter that save Britain.
Then there’s the Mosquito. The first “Stealth” aircraft. The radar of the day was primitive and expected to work on giant metal blobs with corner reflectors build into the surfaces. Being wood, the Mosquito often surprised the heck out of folks. Pilots learned to fly in fast and low, pounce, and be gone before the sirens could wake anyone. Designed to be easily built and not put increased demand on scarce aviation metals, it was essentially a “Composite” aircraft before we had the name.
FWIW, I’d also toss in the P51 Mustang. Started out doggy due to an under-powered engine, but once the Rolls Royce Merlin engine was installed, it became a stellar fighter. Stayed in service (Dominican Airforce) until 1984. Think about that a moment… It changed the balance of power in the Air War in Europe via long range bomber escorts.
I still wonder why nobody makes a civilian version of one of these today. The design has already passed FAA qualifications ( I think) for a type certificate. They are built with 1930s and early 1940s technology, so no hurdle there. Folks pay up big money to buy one in flyable condition. Just seems ripe for a Replica Manufacturer… Then again, the Merlin Engine is also a bit unique UPDATE:
(rotary sleeve valves are tricky…)so maybe just getting an engine is problematic. Yet folks swapped in a Turboprop on what is basically a P-51:Update: The Merlin was sodium cooled poppet valves. It was the developed but not produced Crecy that had sleeve valves:
https://en.wikipedia.org/wiki/Rolls-Royce_Crecy
https://en.wikipedia.org/wiki/Piper_PA-48_Enforcer
IIRC, the Mosquito especially was suited to small shop parts production.
Oh Well, just another one of those things I wonder about… Like why it costs $100,000 for what is basically a new 1950’s airplane with about $10,000 of parts and materials in it… Sometimes I think the FAA deliberately killed the Civil Aviation movement of the 1960s…
jim2 quotes: No vaccines are 100% protective, so cases, hospitalisations and deaths are still to be somewhat expected among those who’ve been jabbed – and especially in those who are older.
Even at best, the covid vaccines are roughly 90% effective, which is pretty good for a vaccine. But if we take this statement at face value, we blame the vaccine for not working for 10%. My take on this is that the vaccine itself provides ZERO protection. It is not supposed to. What it is supposed to do is make your own immune system better equipped to fight that virus. If you happen to have a weakened immune system, for example by being old, the vaccine boosted immune system is still not good enough.
Which is another reason why the deemphasis of IVM, Vit D, etc etc is criminal.
@Rhoda Klapp:
Because gliders are built with extraordinary high lift wings and absolute minimal weight, then hang out in thunderheads and thermals that rise way high way fast that would tend to break other aircraft, or their speed would not let them circle in it…
My Dream Personal Aircraft would be a glider with a small engine in it. Just enough to hold it in the air if you ran out of lift and get you to the next one. Done right, you ought to be able to travel hundreds of miles on a gallon of fuel… perhaps a thousand if you are good and the weather is right.
FWIW, I took some glider lessons at one time. Would have gotten my licence too but they closed the glider port and moves far away… It is a far more pure and pleasant piloting experience than a powered aircraft. It demands more from you, but the plane just does not want to go down… We had spoilers to deploy on landing or you would just float over the runway ;-)
EMS – Dream come true? There are quite a few gliders with engines – electric and otherwise. But the idea was to allow the glider to take off without a tow. I’m guessing it would work for your use case also.
https://www.pilotmix.com/tst-10-m
https://www.pilotmix.com/jantar-turbo
Single overhead cam, four valves per cylinder.
Being dutch I would have to put in the Fokker G1
Antony Fokker wanted Merlins for it but was denied.
Things to do with that old Merlin engine …
https://siamagazin.com/the-beast-a-27l-v12-rolls-royce-merlin-engine-street-legal-car/
I had a mistake in my comment above about the Merlin. It was a sodium filled stellite poppet valve engine.
From the wiki:
https://en.wikipedia.org/wiki/Rolls-Royce_Merlin#Basic_component_overview_(Merlin_61)
It was the Crecy engine that had the sleeve valves:
https://en.wikipedia.org/wiki/Rolls-Royce_Crecy#Performance
Never put into production as it was overtaken by jet engines…
Rolls-Royce has made some of the most interesting engines around, and it seems I can’t keep them all straight anymore ;-)
FWIW, there were sleeve valve engines in use in W.W.II aircraft. This one is a favorite:
https://en.wikipedia.org/wiki/Napier_Sabre
These are the same folks that made one of my other favorite engines of all time. Used in fast boats and in British Rail Engines. The Deltic. 6 opposed pistons in 3 cylinders per row with 6 rows for 18 total cylinders and 36 pistons.
https://en.wikipedia.org/wiki/Napier_Deltic
One of these was hauled out of the museum and pressed into service when snow caused the electric feed to fail…
An absolutely wonderful engine, that’s just a bit fussy about being properly cared for ;-)
E.M.
Re A new Mosquito
There is a crew at Ardmour in New Zealand that has built a set of moulds for making new fuselages. The rest is pretty well straight wooden aircraft technology. They did about the last one to become airworthy.
There is a weight and balance problem with using turbines rather than piston engines, as the turbines are a lot lighter. Might be less of a problem with a twin.
Incidently I put that item up at Jo Nova and, in this covid era, the first comment says
“Finally something that was properly tested”
And gliders
https://www.nbcnews.com/mach/science/experimental-glider-smashes-record-high-altitude-flight-ncna907586
Most of the height records are on mountain standing waves – used to be the Sierra Nevada one, now the Andes. The wooden gliders I was around were a fair bit stronger in +/- G’s than your average Cessna.
Read and beware
https://bayourenaissanceman.blogspot.com/2021/07/america-has-lost-trade-war-with-china.html
Memes that made me laugh 68
https://bayourenaissanceman.blogspot.com/2021/07/memes-that-made-me-laugh-68.html
AI – the affair with China is sad, but just about all of us are to blame. We like low prices just like we like to burn hydrocarbons. Part of the blame lies with us as well as profit hungry companies. Now that that’s sorted, the question is how do we fix it. The fix might be painful, but much less painful than a strong China.
@Another Ian:
You could always put lead cowlings around your too light turbine ;-)
@Per China:
China is indulging in predatory Mercantilist Practices. They cut their currency exchange rate to always remain the low cost producer, put up barriers to selling into their country, and a whole lot more (not to mention the Must Share all IP and Must Sell 51% of any operation in China to China).
The way you fix it is “countervailing pressures”. Trump had a good start with the tariffs. Then you explain that any devaluation of the currency will be offset with a matching tariff increase. You forbid the entry of any product made with stolen IP and forbid the export of IP to China. Require than any Chinese company doing business in the USA sells 51% to the USA (and explain if they will stop,l you will stop). Etc. Essentially “Be The Mirror” with some teeth added.
We didn’t lose the”Trade War”, we never bothered to fight it… Our Dear Leaders put the USA up for sale and just asked what their Vig would be… (Vigorish, or “cut of the action”).
@Another Ian:
That’s a good set of memes ;-)
BTW, I think I know this person:
This would be a great fiction book, but it isn’t. Doh!
https://www.zerohedge.com/markets/cascade-consequences
All I can say is, I am not surprised. Put down that processor or we will take you into custody. Bitcoin miners beware!
https://www.zerohedge.com/political/59-million-americans-prohibited-buying-high-end-dell-gaming-pcs
@Ossqss:
That California Law is a hoot. Guess who won’t be leading the world in computing anymore… Can’t let our Engineers, Software Designers and Programmers have the fastest machines after all…
So now we get to have a Black Market internally in high end computers…
Also: That Cascade Of Consequences link it great.
I’d been pondering a “What do we know” posting about just that. Ticking off the facts in evidence and how deep the lies are. Normally I’m a bit “sprinkle grains of salt in it” about Zerohedge, but that one’s a keeper. (I’ve only read about 1/2 of it so far, but it’s spot on.)
@EM, it was reproduced on ZH, not originated.
We iive in challenging times, for all the wrong reasons.
Re the praise for the Spitfire you should realise that it wasn’t what the Air Ministry wanted. It was originally set in process by Air Marshall Dowding, who wasn’t the favourite in the hierarchy as he was in favour of fighters. The rest believed that “the bomber would always get through” and winning was only a matter of the most bombers, which they ordered with little forethought. See the Handley Page Heyford for their idea of a heavy bombers.
The infatuation grew so bad that the Treasury demanded 25% of funding be spent on fighters. Even then the figures were “fudged” and only half that was spent. They were convinced that their theory (without any proof) was right. Parallels today?
The production of the Spitfire Mk1 was slow and the Air Ministry tried twice to cancel the contract but were over-ruled. The other fighter was the Hawker Hurricane, which was originally built for export. It was (originally) as fast as the Spitfire Mk.1 but “modifications” soon fixed that (much as they did with the Brewster Buffalo which was rended inadequate for use although the Finns thought highly of it; as they did of the Hawker Henley which was also rejected by the British Air Staff.
Indeed more Hurricanes were used in the Battle of Britain and downed more German planes.
Also, there were 3 Spitfires, Mark6 would have been the second design and (I think) Mark14 the third. They retained that wing shape but it was expensive to manufacture (a Spitfire Mk1 cost about 4.5 times that of a Messershmidt 109E). They were impressed by the Mustang and tried to marry its wing type with a Spitfire body but bungled see the Spiteful https://en.wikipedia.org/wiki/Supermarine_Spiteful
The bungles by the Air Ministry bureaucrats up to and in WW2 were numerous but they were ‘rescued’ because the German Air Ministry were even worse at getting superior planes into service.
While it’s true that the UK Air Ministry didn’t expect the Spitfire to go beyond the initial peacetime order, and did not have anything to do with the other two war-winners, the Lancaster and the Mosquito, the system did work to the extent that it was flexible enough to see sense. The US Air procurement system was as bad. P-38 was the only one originated by a US specification, the P-47 was private venture and the P-51 was strongly resisted until 1943. In the US too bombers were the main effort, fighters were orphans. And despite the money spent on bombers in both countries neither could field an effective bomber force at the beginning of their respective wars. For example the RAF did not have proper navigator training, they couldn’t find their target even in daytime unless they were on the coast.
“@Another Ian:
You could always put lead cowlings around your too light turbine ;-)”
Have you been reading too many “EV’s?”
A couple more incident like this and we’ll see a refund the police movement among the Dimowits.
Former Sen. Barbara Boxer (D-CA) was assaulted and robbed in Oakland, California, on Monday afternoon, according to a statement posted by her Twitter account and confirmed by local police. No gun was involved in the daylight robbery.
https://www.breitbart.com/crime/2021/07/27/former-democrat-senator-barbara-boxer-assaulted-robbed-in-oakland/
If you fancy having a covid chill run down your spine, take a look at what the first commenter here has to say about the ongoing plans of “The Mother Of Parliaments” for the citizens of this once free country:
https://independencedaily.co.uk/your-daily-betrayal-tuesday-27th-july-2021-the-covid-emperors-are-nekkid/
As the second commenter says, “No wonder the citizens of the US won’t give up their Second Amendment. If only… “
Re the above, I now notice that it was (at the time) the latest comment.
I mean, ‘flyer at July 27, 2021 at 12:19 pm’
– the ‘second comment’ is the first reply to that.
@Steve C.:
Yup. THE big question is just how much of the US Population has been so dumbed down and conditioned to accept any kind of crap such that we actually do nothing. Is it still possible for a “Popular Resistance” to stop the fraud and coup?
What bothers me most? This is clearly being done “to plan” at a global level and across all nations (with special emphasis on the destruction of National Democracies). We are in a Third World War, and losing, and folks don’t even realize it.
We’ve had a few times now that a “simulation” of one thing or another was done, and then, by golly, just a couple of years later it happens… as those Oh So Prescient modelers clearly saw the future… that just maybe they created. Gates & Co. modeling a Corona Virus Pandemic just in time? Really?
FWIW, I find the quote near the end of this (at 6:15) , from Kissinger chilling:
https://www.bitchute.com/video/VM9Uts0zj3HM/
Basically saying forced vaccination is the gateway to forced organ donation and eventual “culling of the herd”…
@Jim2:
Naw, they will just hire more private security for the rich and powerful.
What might force a ‘refund the police’ policy change? Mobs cleaning out the high end retail stores on a regular basis with zero risk / punishment. When Babs Boxer can’t just go by a replacement Gucci Bag due to empty shelves and every bum on the street has one, that will be unacceptable… /snark;
We’ve already got the likes of Target and Walgreens abandoning San Francisco. The Theft Rings and Mobs have not abandoned their lucrative racket. That means a new target is on offer. Neiman Marcus was just hit per one video showing a mob cleaning them out. When there is no “shopping” left that’s safe from the theft, those companies will lean on the Dims and maybe something will improve. But, you see, the Dims can not see the consequences of their policies and actions. Even after the fact in many cases. It takes prolonged pain (and cash flows) for them to do anything.
Since Soros is funding this crap, it will take a large counter cash flow to stop it.
OTOH, it can be fun to watch the Progressive Socialists suffer distress at the end point of their own policies…
I really think they’re just f-ing with us now.
https://www.forbes.com/sites/alisonescalante/2020/09/08/why-speaking-english-may-spread-more-coronavirus-than-other-languages/?sh=9aff10b6eeaa
EMS – maybe a mob will raid Peloser’s ice cream collection. ;)
@Jim2:
I’m sure that would get police funding restored pronto!
@Jon K:
Yup. As though English is the only one with aspirated consonants… How about those guttural through clearings of German and Dutch and the CH of Scottish, eh? Or the plosive P in some African languages? IMHO, either the author doesn’t know much about other languages, or they are just making up crap for a paychek. I suspect the latter and they spent so much print lamenting professor spit in college when I don’t remember even noticing it at all and had zero “empty front rows” after the first week. So it fails a reality test right there.
Oh, and then there’s Arabic… glottals and fricatives galore often delivered with rapidity and force…
If you really want to get into aspirated fricatives, it looks like Asia is your place:
https://en.wikipedia.org/wiki/Fricative
Then there’s the Plosives…. don’t even get me started on Plosives in various languages…
@E.M. – Re “The Plan”- your own FDR once said that “In politics, nothing happens by accident. If it happens, you can bet it was planned that way.”. Let’s face it, he was in a position to know.
Example: I’d decided well before last century was out that “multikulti” was clearly doing Britain far more harm than good and needed to be undone. I was, therefore, especially interested to come across the following little detail.
When the SS Empire Windrush docked, uninvited and unexpected, in Britain (June 1948) and disgorged the first bunch of Jamaicans into what had until then been a very racially pure white country, the Home Secretary of the day- understandably – wanted to ask a question in the House asking what the hell was going on. His legal advisor told him that he couldn’t ask the question because it would be racist. That poison dart had already been blown into British law even then, and baby, won’t you look at us now.
@ EM re:
‘Basically saying forced vaccination is the gateway to forced organ donation and eventual “culling of the herd”…’
I thought I could smell that coming…the forced organ donation, I mean. It reminds me of this little ditty (sung to the tune of East Side West Side):
East Coast, West Coast
and Chicagoland
What’s that? You’re shopping for kidneys?
Oh hey! I know a man…
He can start a street fight
Guys’ll get conked on the head
And we can harvest their organs
While they’re in hospital beds.
It’s interesting to see a case study on how “we” think and communicate.
Click to access 2101.07993.pdf
From the paper “anti-maskers value unmediated access to information and privilege personal research and direct reading over “expert” interpretations”
Well, yeah…
E.M. the Mosquito was not just a small radar signature it was the first WW2, possibly in the world full multi-role aircraft.
During it’s developement from 1941 on it was used for
Light Bomber able to outrun most German fighters with enough range to reach Germany.
A Fighter Bomber which could hold it’s own agaisnt Fighters, so needed no escort.
A Fighter, with 4 Cannons and 4 machine guns it packed a real punch.
A Night Fighter.
A Precision low level Bomber, Operation Jericho as an example.
A Ground attack aircraft, Tank & Locomotive buster.
Medium Bombing 4000lb bomb (same load as a B17 Flying Fortress).
Pathfinder for the big guys.
Photo-reconnaissance.
Antiship and Submarine, fitted with Rockets, Bombs and a Molins “6-pounder Class M” cannon.
Aircraft Carrier based Torpedo Bomber.
Trainer.
Target Tug.
Tester for the Bouncing Bomb of Dambusters fame.
Fast Transport for war time high value cargo.
With extra fuel tanks a range of 5,419 mi les was possible for the PR version.
It had one major weakness, in the tropics the moisture and Mould got to the glue in the laminations and caused structural problems.
Quite some outcome for a private venture wooden aircraft that the War Ministry weren’t really interested in, which is why they called it the wooden wonder.
Had to read the CDC link again after I read this one. Now we know where the flu went, eh?
https://thelibertydaily.com/cdc-quietly-revokes-rt-pcr-emergency-use-authorization-because-they-counted-covid-19-and-influenza-together/
Your blood on vax
https://odysee.com/@BannedYouTubeVideos:4/WHAT-COVID-INJECTIONS-DO-TO-YOUR-BLOOD!-DOCTOR-RELEASES-HORRIFIC-FINDINGS:8
Ossqss – corona viruses don’t cause flu, influenza viruses do that. Not seeing how the PCR test could confuse the two.
Jim2, not only is the PCR test inaccurate and not made for this purpose, evidently it cannot discriminate between the 2, per my CDC link from a few days back above in this thread. I did not recognize the admission when I first read it as I was thinking the same thing you were.
https://www.cdc.gov/csels/dls/locs/2021/07-21-2021-lab-alert-Changes_CDC_RT-PCR_SARS-CoV-2_Testing_1.html
Ossqss – the point of the bulletin is to have labs to switch to a test that detects BOTH flu and covid. This, as it says, will save time running tests. I don’t interpret it to mean the covid pcr test tested positive for flu. Nowhere does it say the covid test went positive for flu.
CDC encourages laboratories to consider adoption of a multiplexed method that can facilitate detection and differentiation of SARS-CoV-2 and influenza viruses. Such assays can facilitate continued testing for both influenza and SARS-CoV-2 and can save both time and resources as we head into influenza season.
https://www.cdc.gov/csels/dls/locs/2021/07-21-2021-lab-alert-Changes_CDC_RT-PCR_SARS-CoV-2_Testing_1.html
The test that detects both flu and covid makes sense because doctors will be going on symptoms when they order tests. Both flu and covid present respiratory symptoms, so it makes sense to have a test that will work for both.
I found what is an attempt at an explanation, but not a very good one IMHO. It does however expose how poorly the communication is on things across the board with the medical community.
https://redstate.com/katepauldillon/2021/07/26/much-ado-about-pcr-testing-and-cdc-changes-n416653
This was a great comparison of positions.
https://www.theautomaticearth.com/2021/07/a-tale-of-two-narratives/
Re another Mosquito
A bloke in NZ bought a low hours one as war surplus. It has surfaced out of his estate non-flyable but all the bits there and IIRC gone to that business at Ardmour. There is a video of the first engine now running.
If you haven’t been following this, the Cali election Stasi tried to keep Elder out of the race entirely, but the courts threw them a curve, so he is in.
And a UC Berkeley Institute of Governmental Studies/Los Angeles Times survey released on Tuesday indicates that conservative talk radio host Larry Elder, who won a court battle last week to appear on the ballot, is the current front-runner among the nearly four dozen candidates running to replace Newsom, should he be recalled.
It’s a small victory he’s in the race, it would be a huge victory if he won. But then, there would be the legislature to deal with.
https://www.foxnews.com/politics/recalling-newsom-likely-california-voters-split-poll
You might say “hosed” (2014 though)
“Only the French know how to protest”
https://www.armstrongeconomics.com/world-news/civil-unrest/only-the-french-know-how-to-protest/?utm_source=Newsletter&utm_medium=Email&utm_campaign=RSS&__cf_chl_jschl_tk__=pmd_aa40b51df1f82f8b2a7c125a5484fa9c32206ad4-1627423395-0-gqNtZGzNAqKjcnBszQ-i
An interesting development in the Mann defamation lawsuit against Rand Simberg and Mark Steyn has dropped, without, so far, the most critical analysis.
The judge ruled on the admissibility of various “experts’ testimony”. All of Mann’s proposed experts were considered to be unrelated to the question of defamation. Steyn, however, had asked for a statistician named Abraham Wyner to present testimony. The judge allowed this expert to partake in the case to be presented to the jury.
The statements Mann complains about relate to him “torturing data” to produce the “fraudulent” Hockey Stick. (That he was indirectly compared to a child molester / sexual predator was not a matter that has survived the court system.) In roughly 2009 Wyner and a partner statistician published a peer reviewed article in a respected statistical journal arguing that the statistical methods — data selection and analysis both — used in Mann’s work were … not capable of bearing the weight of the importance placed upon the results. This was roughly contemporary with the Climategate email scandal. And the whole thing was widely discussed on Steve McIntyre’s ClimateAudit blog — which Steyn has admitted (“bragged about”, might be more accurate) following in the three years prior to the publications at issue.
Steyn doesn’t need to be a climate expert or an expert statistician to show he relied upon secondary media (the blog) in forming the opinions he expressed. So the question becomes whether (a) the reports in the media accurately conveyed the gist of Wyner’s findings and (b) Steyn’s opinions can be reasonably interpreted as derivative of Wyner’s. Wyner is the expert most capable of assessing both. He will be allowed to present for the defense. Mann has no such experts in his corner, as of today’s ruling.
The Greeks are getting better at it…
jim2
There are more corona diseases than the Peking Pox
” the group of viruses cause respiratory tract infections that can range from mild to lethal. ”
https://en.wikipedia.org/wiki/Coronavirus_diseases
jim2 says: 27 July 2021 at 8:03 pm
Ossqss – corona viruses don’t cause flu, influenza viruses do that. Not seeing how the PCR test could confuse the two.
Not according to these people.
Quote
“What we found was that all of the 1500 samples were mostly Influenza A and some were influenza B, but not a single case of Covid, and we did not use the B.S. PCR test. We then sent the remainder of the samples to Stanford, Cornell, and a few of the University of California labs and they found the same results as we did, NO COVID. They found influenza A and B.”
https://stillnessinthestorm.com/2021/02/imaginary-and-fictitious-clinical-lab-tech-tests-1500-covid-positive-cases-only-finds-flu/
Some more aircraft
https://bayourenaissanceman.blogspot.com/2011/06/weekend-wings-39-south-africas-franken.html
Links to Parts 2 and 3
The Drudge Report, that longtime haven for conservative news and wacky headlines on the internet, has gone lamestream, and many conservatives have launched new platforms to replace the gaping hole it has left behind.
Even a former editor of the Drudge Report, Joseph Curl, has stepped up to resurrect the Drudge spirit. On Tuesday, Curl announced the launch of Off The Press, a conservative-oriented aggregator that he says will have a “fearless attitude” toward covering “everything for those who devour news all day,” Just the News reported.
https://pjmedia.com/news-and-politics/tyler-o-neil/2021/07/27/former-drudge-report-editor-launches-conservative-alternative-n1464957
@Jim2,
It is rather easy to see how a PCR test can get diagnosis wrong. PCR tests detect nucleic acid strings. Nucleic acid strings are *not* unique, and that is particularly so for short ones. All it would take is for the primer to bind to a string and start the replication process. Depending on how positive tests are determined, say via Western blots, even if the primer and replication is done reasonably accurately, the other part may go wrong, too. Thus, you’d need to isolate the source, culture it, examine it with an electron microscope (for viruses), then use one culture to transfer it to another one to be sure you truly have a potentially transmissible pathogen. Then, you must determine the minimum infectious dose.
I am having trouble reaching richardsonpost.com right now (site unreachable). Anyone else seeing this?
@ https://chiefio.wordpress.com/2021/07/23/w-o-o-d-23-july-2021/#comment-148114
CDQ – The COVID PCR test selects on a string of nucleic acid unique to COVID-19. So, it’s not going to show positive for the influenza virus.
richardsonpost.com loaded OK here in the UK just now, no problems.
ACO – from your link:
’m a clinical lab scientist. I have a PhD in virology and immunology. I’m a clinical lab scientist and have tested 1500 “supposed” positive Covid 19 samples collected here in S. California. When my lab team and I did the testing through Koch’s postulates and observation under a SEM (scanning electron microscope), we found NO Covid in any of the 1500 samples.
So he uses the word “supposed” ??? That tells me nothing. He doesn’t say these cases were diagnosed by the PCR test, does he? It is meaningless drivel.
another ian @ https://chiefio.wordpress.com/2021/07/23/w-o-o-d-23-july-2021/#comment-148106
Yes, there are other corona viruses. So what?
First, the PCR primer ‘copies’ bits of genetic material only if it matches specific genetic sequences unique to COVID-19. Yes, unique. Since we have the sequence of SARS-CoV-2 as well as multiple influenza viruses, we can be sure that the test is searching for sequences that are unique to SARS-CoV-2 and not found in any of the other viruses
https://redstate.com/katepauldillon/2021/07/26/much-ado-about-pcr-testing-and-cdc-changes-n416653
Since I’ve done PCR work, and I know quite well that purported unique covid-19 nucleic acid sequences are said to be unique, but have not been shown to be unique; I, for one, don’t believe it.
Maybe they are fiddling with the DNS in the USA, since I am still getting errors.
CDQ – Since you do this type of work, what part of the influenza genome matches the chosen sequence in the COVID-19 genome? If there is no match, there is no way influenza would make the covid test show positive.
I know someone who recently got a COVID PCR test and it was negative. How do you explain that?
Been reading the interesting discussion here regarding rt-PCR test method. Mid to late last year I was researching probes and forward/reverse primers to understand the operation of this test method and the actual test “output” used to declare the presence/lack of presence of the Wuhan virus. Piqued in part by Kary Mullis’ rather trenchant views on the (mis)use of the PCR manufacturing process for medical diagnoses.
Below is some of what I found during my research.
Off-Guardian article; 11/17/20
Extract
…
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:
RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
E gene (Orf1ab) – small membrane protein used in viral assembly
N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.
It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.
…
End Extract
From a Spanish health journal – D Salud; November 2020 article
Extract
…
The question we asked ourselves then was: if the sequences that have been published do not
belong – as claimed – to new viruses, where do they come from? And to try to answer that
question we decided to carry out a search with a computer program called Basic Local Alignment
Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given
sequence with all the sequences stored in the National Institutes of Health of the United States (it
is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by
step what we did so that our readers can repeat the search for themselves and check the results.
First we collected all the initiators of the PCRs described in the protocols hosted on the WHO
website at the time which were these:
– China CDC protocol: uses ORF1ab and N genes as target.
– Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to
be SARS.CoV-2 specific).
– United States CDC protocol: uses three fragments of the N gene.
– Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as
target the S gene together with other genes supposedly shared with other coronaviruses.
– Charite Protocol (Germany): uses the E, N and RdRP genes.
– Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.
– National Institute of Health Thailand protocol: uses the N gene.
We then introduced the sequence of the primers – the one that indicates the beginning of the
sequence to be detected (forward) and the one that indicates the final (reverse) – into the BLAST
so that it could search for them in two databases: a collection of microbe genomes and the one
corresponding to the human genome.
THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN
HUMANS AND IN NUMEROUS MICROBES!
Let’s see in detail the procedure taking as an example the initiators of the French protocol. Once
on the BLAST website, we chose Microbes to search the microbial genome databases and moved
to the next page. Then a form appeared in which we entered the sequence of the forward initiator
of the French protocol -that is
ATGAGCTTAGTCCTGTG
we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds
later the results appeared -we took a screenshot (image 1)- and we were shown 100 sequences
of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with
an identity percentage of 100%.
We then returned to the home page and that second time we chose Human to search the human
genome, we repeated the same operation and after a few seconds the result appeared which we
screen captured again (image 2). And it turns out that the sequence entered coincides with 74
sequences of the human genome, with a coincidence of between 66% and 100% and a
percentage of identity of 100%.
And that indicates that the sequence of that initial PCR primer that is supposed to be specific
to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred
microbial fragments as well!
We then decided to repeat the operation but with the final or reverse primer – which is
CTCCCTTTGTGTGTGT
– and the results were similar.
Since these were very short sequences -about twenty genetic letters or nucleotides- we decided
to try again but with the target sequence defined by these two primers, i.e. the sequence of the
supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously,
for this we needed the sequence that is officially claimed to be the “SARS-CoV-2 genome” and
although thousands of laboratories claim to have isolated and sequenced it -a false claim as we
have explained in previous reports- we decided to go to the National Centre for Biotechnology
Information website:
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903.
Once there, we located the “target sequence”, a fragment of 108 nucleotides located between positions
12,690 and 12,797 of the “genome”, which is this one:
ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT
GACAATGCGTTAGCTTACAACAACAAAGGGAG
With this we repeated the steps previously described and the results were again surprising since
there appeared again a hundred microbe sequences with a percentage of a match of 100%
and four sequences of the human genome with an identity percentage between 83% and
95%. The matches were therefore lower but the important thing is that we continue to find
fragments of the supposed “target sequence” of SARS-CoV-2 both in microbes and in our
own genome.
Truly astonished we took a further step and tested with the gene considered at that time as the
most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and
is located between positions 26,245 and 26,472:
ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCT
TTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTG
TTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG
ATTCTGGTCTAA.
We repeated with it the steps already described and the result was even more surprising because
despite its length another hundred microbe sequences appeared with a percentage of
identity of 100% and 10 sequences of the human genome with a percentage of identity
between 80% and 100%. And similar results were obtained with a fragment chosen at
random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2
nucleocapsid.
We finally decided to test with the S gene which is said to generate the structural “spike” proteins
that are key to entry into the cell and was subsequently considered to be the most specific SARSCoV-2
gene. Since it is a gene whose sequence is much longer – 3821 nucleotides between
positions 21,563 and 25,384 – we tested with two fragments chosen at random within that gene
and the first –
TTGGCAAAATTCAAGACTCACTTTC
– resulted in another hundred microbe
sequences and 93 sequences of the human genome and the second –
CTTGCTGCTACTAAATGCAGAGTGT
– a hundred microbial sequences and 90 of the human
genome.
Finally we decided to test with the initiators of the Japan Protocol, the only one that includes
target sequences of the S gene and, the reader will have already guessed, the results were once
again similar: a hundred microbe sequences and 93 sequences of the human genome with
an identity percentage between 94.12% and 100%!
…
End Extract
@jim2,
I’m retired now, so can’t answer you off the top of my head; but I do know that it has long been said that phylogenetic trees can and have been done by comparing matches and non-matches between organisms. Point me to published, and verified sequences, then I may see about answering the questions.
Explaining a positive or negative test also requires knowing specifics of the tests and how they are performed. With that, I’d need an idea of the true prevalence, sensitivity, specificity, and false positive or negative rates for the tests.
Thank you, DoNoNorth. That’s what I am talking about.
It seems if humans have the covid-19 “magic” sequence, one would never get a negative PCR test for covid. Yes, I know people who have had negative tests.
Oh, I forgot, yes the covid test can show a positive from a fragment of influenza virus or any other fragment. It just has to bind to it and initiate replication. Bad primers, bad reagents, poor specimen sample, poor lab technique, any source of contamination and the vagaries of wet chemistry make it possible for a false positive covid test from an actual influenza, or other, infection.
@CDQuarles:
It was slow to come up, at first giving me “site unreachable” then about 30 seconds later started to load and about a minute later was up. I would suspect either a very big spike in popularity as some story goes viral, or a DDOS attack on either the site, DNS providers, or the internet at large.
@Jim2:
The basic issue is that you have a high belief in the perfection of the chemical process of the PCR-DNA test; while biology in wet chemistry is messy with a lot of quasi-random bits and sporadic anomalies.
Mix in that every single person is a unique genome, and that “crap happens” both in the collection and processing of tests, and that the test itself has a certain degree of stochastic error in it, and you can get a variety of quasi-random results.
In short, it is a crappy test. That’s why the inventor of it says not to use if for diagnosis.
In particular: It is an amplifier. The “gain” depends on cycles run. At about 40 cycles you have a gain somewhere of 1 Million. At that point, a “one in a million” random error in chemicals binding (due to a cosmic ray energizing a nucleic acid that then gets the hots for a neighbor it wasn’t supposed to bind too… for example) can show up as a False Positive.
EVERY Medical test has some statistical False Positive and False Negative statistical rate.
What makes this one pernicious is that you can increase the False Positives to unity if you just run the cycles enough times. You can start with NO sample to test and get a POSITIVE if you run enough cycles. The supposed best cycle rate is about 25. Tests were being done at 40 and throwing false positives like crazy.
Now, two issues you seem hung up on. 1) Humans have the genes, test doesn’t find them. 2) Influenza doesn’t have them yet the the test finds them.
I’m speculating here, but it is informed speculation.
1) A quick swab of a mucus coated nose will get few or no human cells into a sample. Then that sample gets treated and some small part of it ends up in the PCR test machine. Did a human cell make it? Was the amount that made it still bound up in a structure preventing being seen by the test? (i.e. the nucleus didn’t break down or human DNA blobs were so big they got filtered out in some step?) Was the sample of human DNA that made it too small to trigger a positive in a properly run 25 cycle count test? Plenty of room for Human DNA to have a matching fragment and not throw a positive.
2) A sequence does NOT need to be identical to give a false positive on a high cycle count test. IF the flu starts out with an 80% match segment, it can, via the random errors of wet chemistry, be slowly changed to a closer match and then amplified more, changed more, etc. until it has enough match and volume to toss a positive result. That’s a BIG part of why cycle count matters. The closer (though still not identical) the contamination might be, the fewer cycles it takes to get a false positive. So you need to know “how close”, not “is it the same”. Add to that the long history of virus and bacterial sharing of segments, that DNA is far more alike between species than most folks expect (WE have about 17% viral DNA in us, including a key protein in the placenta that makes us mammals. Search on that protein coding DNA and you will find LOTS of viruses…) and it becomes fairly likely that some segments are shared “enough” between The Flu and Covid-19 for a modestly long cycle count test to find a positive for both of them
The shorter the segment, the higher the probability that there’s an identical segment in other species / animals / plants / viruses, etc. At “1” it is a given. EVERY living thing has an “A” a “C” a “G” and a “T”. These are grouped in “3” letter codons that match a particular amino acid (simplified… actually several different 3 letter groups code for the same amino acid, so many substitutions give the same protein). Then, larger segments are also commonly shared. Some are highly conserved, so, for example, all animals have a Kreb’s Cycle with the same general enzymes in it. So the same genetics. WE are about 97% to 98% Chimpanzee and almost as much matches the Pig genome (though the control structures and gene locations are different so the result is very different). At the 100% length of 100% of all your genes, your sequence is absolutely unique (so is used for forensic identification- modulo identical twins). Somewhere in between those two it is “unique enough” for particular purposes. Where that is, is something of a bit of trial and error and error and guessing and trial…
So just how well did the PCR test guys “guess” on the unique bit to use for the test? Nobody knows. But we do know that at 40 cycles it will throw a huge number of false positives and that if you are testing 1 BILLION people ( 10^9) with a false positive rate of 1:100,000 ( 10^5) that will toss 10,000 false positives. It is likely that at 40 cycles the false positive rate is closer to 1:10,000 or 1:1000…. so think about it…
The more you PCR test a large population, repeatedly, with no disease, the more false positives you will find. Folks have in the past created a false epidemic via just this process on other diseases via false positives.
So please do not look for perfection in wet chemistry medical tests. It just is not there. It is subject to fairly high error bars, especially for the PCR tests and dramatically for cycle counts over 30.
Sidebar:
We do not know all the viruses and bacteria that exist in the world. We can not know them all. The rate of mutations and evolution exceeds our ability to monitor it. How many benign unknown viruses and bacteria contain fragments that the PCR test will call a positive test? Nobody knows. In a normal case, that kind of error is discovered over time and the test incrementally improves as folks discover things like “Eating an avocado before the test gives a false result”. Note that kids have found you can get a false “positive” on the rapid tests via drinking various beverages and are using it to get days out of school and other duties. IIRC, anything acidic will do it. Coke, Gatorade, Red Bull. It triggers a runaway reaction as the test expects neutral pH, so tossing a false positive.
ANY time I get a positive test on ANY important medical condition, I’ll ask for a second confirming test. Why? I was diagnosed with an STD via a routine test. The problem was I’d not had sexual contact with anyone but the spouse, a devoutly devoted person of no “swinging” tendencies. I called “BS” and had me retested, the spouse tested, and special care done in the testing. The result was a “Never Mind…” instead of a marriage crisis and medical STD record. The folks doing the testing changed labs they used after that event…
In Conclusion:
I would not trust a PCR test at cycle counts over about 25 at all for anything. I’d be highly skeptical of it for most things even at 25, and I’d want a couple of confirmations before I’d believe it. Why? Because it is a lousy test and even the inventor of it says it isn’t suited for diagnosis. I’d be especially skeptical of it finding Covid-19 as there are so many other corona viruses floating around at any one time that I’m fairly certain they have not tested the test against all of them to show it doesn’t false on their closely related proteins.
EMS – I don’t have time to unpack all that right now, but I would note I don’t expect to find anteater genes up my nose. Just sayin. It’s not reasonable to expect any kind of plant or animal matter there. So any similar genomes would have to be something that would commonly be there. Also, I didn’t say the test was perfect. I did ask to be shown the flu segment that matches the covid one though.
On cooking rice and dry goods storage
https://bayourenaissanceman.blogspot.com/2021/07/very-useful-advice-from-someone-who.html
That’s just it, jim2, you do have anteater genes and viral genes and bacterial genes and fish genes and many others, in yours and my genome. Length of the string matters. Also, not all of these are activated. Every breeding operation does genetic modification.
Max potential gain for a 40 cycle PCR test is 2 to the 40th power; or about 1.1 trillion in decimal. In real life, the gain is probably a bit less.
I would note, the CDC did mandate the 40 cycle count until about 6 months ago. I posted such CDC links here back then. That is the same timeframe the 300k+ cases/day started to diminish. How does that change with the Delta variant? Dunno, they have designated a 28 cycle count test for symptomatic vaxxed people as of my last peek. I don’t recall the country that had their Supreme Court throw out the PCR test, but they showed up to a 97% inaccuracy rate when they did it.
Think about how many fewer cases we would have at hand if we actually had a good test to use? Think about how many deaths have been attributed, due to financial reasons, to Covid that aren’t from Covid. I just spoke with some in the medical community who see attribution (presumed), without testing, being documented because of a 33k incentive for a hospital last week. Last year it was up to 75k/per. Just sayin… Queue up the O’Jays!
“CDC makes it official: the voodoo ‘vaccines’ don’t work”
https://catallaxyfiles.com/2021/07/29/cdc-makes-it-official-the-voodoo-vaccines-dont-work/
“The more you PCR test a large population, repeatedly, with no disease, the more false positives you will find.”
This applies to other (non-PCR) medical tests too. Recently there has been a campaign to do LESS cancer screening because the tests were finding too many (false) cancers.
To most of us, the PCR test is a black box. Why should we trust the magic box if we have no idea how it works, or if it works? And they keep too much secret, bad sign. Google uses black box tests to find all the “misinformation” on YT, but whatever it uses WE know it is wrong.
Over a year, and there is still no test that you actually have Covid, short of lung scans. Virus particles in the nasal areas, that is not a disease. Runny nose, that is just a symptom of something.
For all the pictures of the virus we see everyday, how many patients are checked for virus particles other than by PCR?
Very interesting video about COVID propaganda:
https://odysee.com/@PandemicParallaxView:6/2020-A-Propaganda-Masterpiece-Prof-Mark-Crispin-Miller-PonP-Episode17:3?src=embed
Consistency? What consistency?
“Biden Administration and Democrats Promote New Mask Mandate, Then This Happens
July 28, 2021 | Sundance | 159 Comments ‘
https://theconservativetreehouse.com/blog/2021/07/28/biden-administration-and-democrats-promote-new-mask-mandate-then-this-happens/
“I would not trust a PCR test at cycle counts over about 25 at all for anything.”
According to the CDC, if the CT is over 28, there is not enough virus there to make it worthwhile sequencing it (to find out which variant). Source: https://www.youtube.com/watch?v=iMyxonl9tVY
(DarkHorse Podcast Clips)
Woke me up alert.
https://earthquake.usgs.gov/earthquakes/eventpage/ak0219neiszm/executive?utm_medium=email&utm_source=ENS&utm_campaign=realtime
Sounds reasonable
Slim is one of the all time greats of Oz country music
I’ve found no evidence that PCR can detect a sequence that isn’t there with a high number of cycles. I did find this interesting report:
https://drexel.edu/~/media/Files/dornsife/News/COVID-webinar-Evangelista.ashx?la=en
Then from the CDC:
Before laboratories use a new test on samples from patients, they must verify the test performance (make sure it works as expected) using “positive” and “negative” control materials. The positive control should always test positive, and the negative control should always test negative. During validation of the CDC SARS-CoV-2 test, some laboratories discovered a problem with one of the test’s three reagents—chemicals required to run a test. The reagent produced a positive result with the negative control, so laboratories could not verify test performance.
https://www.cdc.gov/coronavirus/2019-ncov/lab/testing.html
Here’s another dense paper:
https://www.fda.gov/media/134922/download
Everything I’ve read indicates the PCR test is the gold standard test against which other COVID tests are measured. I know we have to draw conclusions from limited information in an environment littered with false information, some of which is from our own government. It’s just I like to have some sort of proof for assertions and if that isn’t available, I am cautious about jumping to unwarranted conclusions. Unfortunately, we have to make life or death decisions under these circumstances.
What is the check on PCR? That is, how do they confirm a true positive asymptomatic case? Isn’t that situation in itself a bit strange, that you can be positive and get nothing? Did the asymptomatic just throw it off without any other sign? Or did they not even have it?
Labs are supplied with positive as well as negative standards. Their tests have to be validated against those. Just about all tests of all kinds will have false positives and false negatives. The number of cycles needed to detect the virus depends on the amount of virus in the sample. Very low levels of virus would require a large number of cycles to detect it. The number of cycles has to be set by experience with the test. If the genes we have in common with other animals affected the test, we would already know about it. I know someone who is vaxxed and recently had the PCR test. It was negative and so was the fast antigen test.
My main issue was with the idea that flu viruses will test positive by the COVID PCR test. I just don’t see how that could happen, perhaps other than a very few oddball cases.
Vaxxed people can get COVID and be asymptomatic as can younger people, that is less than 50-70 or so. There will always be exceptions to any generality.
another ian says: 28 July 2021 at 10:41 am
It is interesting that the SAAF had Buccaneers, they were a very good design for the day.
The only Nuclear capable bomber to be built to Fighter G levels, designed for very low level (100ft) all terrain flying.
It also had a rotary bomb bay.
It equited itself very well indeed in the US Red Flag war games.
Also, there are “fast” PCR tests, Real Time-PCR (RT-PCR), and longer more stringent ones. I haven’t dug into the differences there yet.
So that false positive rate is against a standard? Is there no other way of distinguishing false positives in the field? Do ‘asymptomatics’ have any other indication of being infected? Because it is all beginning to sound a little like a circular reference.
ACO, many’s the F-15 driver who couldn’t get a shot at the Buccaneers at Red Flag.. Those of us who still look at youtube can find evidence of the low flying Buccs.
Old school here, says that making the PCR test the gold standard is the main problem. The gold standard should be Koch’s Postulates, where confirmation is by isolation, culture, examination, and transmission or propagation. The test is too sensitive and too non-specific, in my opinion.
jim2 says:29 July 2021 at 10:08 am
“Everything I’ve read indicates the PCR test is the gold standard test against which other COVID tests are measured.”
It is only the Gold standard for instant testing.
The Gold Standard of any Virus or Bacteria is to able to get it to reproduce it in a laboratory, ie it is “viable”.
The studies on PCT material from test cycles over 28 cycles cannot reproduce the Virus and therefore the person may have had the Virus but is not infectious.
Which is what the test is supposed to establish.
https://link.springer.com/article/10.1007/s10096-020-03913-9
When Dr Fauci himself says anything over 35 cycles is worthless then you know it is worthless.
This is why when they started PCR testing peop;le were advised to request the cycle count it showed up at.
Some history.
https://telegra.ph/The-PCR-test-is-not-validated-07-31
“The studies on PCT material from test cycles over 28 cycles cannot reproduce the Virus ”
Can you culture a virus from a positive sample at, say, 20 cycles? Do people who set it off at 20 go on to get sick?
There’s a handy little article about the PCR test here:
https://independencedaily.co.uk/the-forty-five-steps/
If you look, you can find:
https://www.reuters.com/article/us-health-coronavirus-tanzania-idUSKBN22F0KF
https://thepoog.com/wp/new-world-order/strategies-behind-the-nwo/covid-19/the-rt-pcr-test/
[…]
Jumping down a ways […]
It just isn’t a very good test. With low population percent actually sick, it throws a very high percentage of false positives. With long cycle counts (as were used) it throws high percentage of false positives. With recovered folks, it throws positives. With virus fragments from the environment (and the vaccinated DO shed spike proteins that can end up in your nose) it throws false positives. Etc. etc.
Embrace it if you wish, but please do so after looking at just how wrong it often is due to such as the above.
And note that since the environment is not absolutely sterile and that DNA wet chemistry is not perfect, yes you CAN run it long enough and get a positive out of nothing. Is that value 1000 cycles? Or is it 40? Is it 32 if you have some snot on the swab? Would be nice to know…
Turn any amplifier up to high enough gain, you WILL get a signal out. No amplifier is perfectly free of noise.
Today Jovan Hutton Pulitzer just released a message related to the 2020 Election results in Michigan:
#MICHIGAN MICHIGAN LEGISLATORS I have been able to secure the verbal commitment from a private donor to fully fund my PKAD initial Forensic Audit of every ballot in Michigan voted in the 2020 General Election. #ScanTheBallots #KinematicArtifactDetection #JovanHuttonPulitzer
It’s time for the lawmakers in Michigan to stand up for freedom and free elections that are fraud-free. Since Michigan politicians claim the election was absent of fraud, they shouldn’t have any complaints in having the ballots from the election audited.
https://www.thegatewaypundit.com/2021/07/breaking-exclusive-jovan-pulitzer-announces-obtained-full-funding-kinematic-forensic-audit-entire-state-michigan/
“Report, CDC Expected To Announce Tomorrow That COVID Vaccines Don’t Work on Delta Variant – Hence, White House Credits Trump With Vaccine Today
July 29, 2021 | Sundance | Leave a comment”
https://theconservativetreehouse.com/blog/2021/07/29/report-cdc-expected-to-announce-tomorrow-that-covid-vaccines-dont-work-on-delta-variant-hence-white-house-credits-trump-with-vaccine-today/
Via Red Power
https://noncompliantmovie.com/
A “Good ‘Ol Boy” who gets it about economics:
https://odysee.com/@MDCreekmore:a/when-the-economy-collapses-this-will:2?
Basic idea: Rampant money printing devalues trust in currency. Best thing to do is get into ~”real value stuff” like tools, land & properties, gold, silver, etc.
While I generally agree with the sentiment, do note that actual market conditions at any one time decide if that is the moment to buy. I’d rather just buy a chunk of Swiss Francs than hop on a Gold Bubble any day. Just sayin’… use the tools I’ve elaborated over the years to decide what is hot and what is too hot…
Me? I’m rolling out of California Land into rural Southern Land…. But that’s just me… ’cause I want to know my neighbors have guns, know how to use them, and don’t take no shit off nobody. I’m particularly interested in Davenport Florida (and not just ’cause Dad grew up near Davenport Iowa…but… ) because it is a largely Black Conservative Town. Maybe I’m a little bit nuts on this, but seems to me that Black Conservatives are more prone to standing up to be counted and to defend their homeland than White Conservatives who seem to have a bit of a RINO problem… But who knows. House isn’t sold yet and it will be 1/2 a year before we land somewhere.
But I’d rather have a Black Brother next to me, armed to the teeth, than a RINO. I guess that makes me a “Ray Cist!!!!!”…
Hi E.M.
Sent you an email re IVM
FWIW
https://www.juliusruechel.com/2021/07/the-emperor-has-no-clothes-finding.html
“1st image of vaccine passport accepted by London’s nightclub bouncers”
https://michaelsmithnews.typepad.com/.a/6a0177444b0c2e970d0278803becfb200d-800wi
Via
https://www.michaelsmithnews.com/2021/07/1st-image-of-vaccine-passport-accepted-by-londons-nightclub-bouncers.html
And here we go again!
“14,000 Scientists Warn of Imminent Climate Tipping Points”
I gather that there is already a song “And here we go again” but I doubt it is about tipping points.
Now here is a list of 41 0f them
https://joannenova.com.au/2021/07/thursday-open-thread-61/#comment-2448277
Which could be used to fuel a song modelled on Bill Bryson’s hiking song in honour of the Princes of Wales, (Notes from a Small Island IIRC) which goes
“I’m the eldest son of the eldest son of (for sufficient generations) of the man who (did something to) Nell Gwyne”
“COVID-19: Blatant propaganda and rampant dishonesty”
https://bayourenaissanceman.blogspot.com/2021/07/covid-19-blatant-propaganda-and-rampant.html
Concerning PCR tests; I have heard it said that the tests report at how many cycles the positive is found. If so, then this is a whole bunch of useful information that is not shared.
Why don’t we know know weekly vaccinated and separately the unvaccinated statistics on…
How many tests are run.
How many cycles are run in the tests.
What the mean positive finding cycle number is. ( if this is known)
What the overall population percentage of vaccinated verses unvaccinated is when each weekly chart is created.
The demographics of each tested group, again, unvaccinated verses vaccinated.
What percentage of positive are symptomatic.
What percentage are asymptomatic.
What percentage are hospitalized.
What percentage die.
What percentage recover.
Mean illnesses time.
Shedding quantities of the positive. ( a smaller group but testable)
Positive or negative movement in each graphic over time. For instance, there is evidence that the earliest vaccinated nations are having the greatest crossover infection rates and increased symptoms. ( A sign that the logical prediction that leaky vaccines self select vaccines resistant mutations, is manifesting, and resistance is decreasing.
Perhaps our governments lack the funds to assimilate such information.
(Sarc). They have the information. That they don’t share it is telling. It would fit on a single spread sheet.
I jest had sausages and mash and a scotch on the rocks. :)
Oops wrong thread! meant to be for the Friends of Oz.
Another Ian. I found this on Cobia. But can’t find her at any hospital. But check out the comments on this page!
Dr. Brytney Snow Cobia, MD
Is this you?Claim your profile
Internal Medicine
10
Leave a review
Grandview Health
840 Montclair Rd Ste 317, Birmingham, AL, 352131 other location
(205) 599-4822
https://doctor.webmd.com/doctor/brytney-cobia-7c00da4c-b21e-48c2-b0ed-03f2a0e5b3be-overview
Also, this …
Dr. Brytney Snow Cobia specializes in internal medicine in Irondale, AL and has over 6 years of experience in the field of medicine. She graduated from University Of South Alabama College Of Medicine with her medical degree in 2015. She is affiliated with numerous hospitals in Alabama and more, including Princeton Baptist Medical Center. Dr. Brytney Snow Cobia is licensed to practice by the state board in Alabama (35481).
Dr. Brytney Snow Cobia also practices at 2000 Crestwood Boulevard, Irondale, AL. She is accepting new patients at her medical office, and available for appointments, preventative care, medical care as well as ongoing patient care.
https://www.topnpi.com/al1265811970/dr-brytney-cobia
Given the small number of comments, and the very similar to identical content of many, it looks to me like one person has spam bombed her comment thread. It may well be that she is a horrible doctor and liar, but maybe not. Even when in need of intubation, some folks can gaspingly speak; and I’ve known folks without a lot of clue about medicine ask for things that make no sense, grasping at a random hope, however silly. It happens.
IMHO, she was most likely exaggerating the reality, but likely did have some truth in it. My guess would be that it was a clueless family member doing the actual asking, so she compressed the story to a one liner. Instead of “Can you give Mom the vaccine?” it became “Patient asked for the vaccine”. I could see that happening often.
Sidebar: I worked in hospitals for about 3 years while putting myself through college. Reception / ambulance radio / admissions clerk; billing clerk; and then a medical records tech working the orthopedics ward; the last one had me wearing a white coat, sitting in the doctors lounge, and reading / correcting medical records (so an order for a lab panel, but no copy, got a copy chased up and added). It being a teaching hospital, I was occasionally mistaken for a Medical Student. On one occasion one student was being grilled about Electrocardiograms and when to give them. He was stuck, and I realized it was a logic question more than a medical question. My answer of “You still need to give the electrocardiogram with a normal pulse rate as they might have tachycardia with a regular skip beat.” was met with significant approval by the teaching M.D. ;-) Who I think mistook me for a fine medical student ;-0 In any case, I’ve interacted with a LOT of patients and their families. Many of them are seriously clueless about anything medical and can ask ridiculous questions.
@Beththeserf:
Bangers & Mash with Scotch rocks sounds like a winner on any thread ;-)
FWIW, I use the cast iron pan drippings to make gravy. Let it cool, add flour to make a paste, then warm gently while adding milk. Slowly raise to the simmer while stirring in more milk to keep it a thick gravy consistency. Salt & Pepper to taste. Simmer about 5 minutes with gentle stirring and you are done. Use immediately, or pour it into a jar and let it cool. Frozen or refrigerated it keeps for days to weeks… except I typically eat it all way before then ;-)
Like many don’t know what life is like for military folk (grunts or officers), policemen, or firemen, they don’t know what life is like for medical personnel, either. Policemen and medical personnel often have to deal with the ugly underside of human beings. That said, good medical people deal with the silly questions with grace and dignity, for either side of the interaction. Still, they’re human and can have “bad hair days”, sadly.
Late in this thread, but here’s an Ivermectin “opinion” in the Wall Street Journal.
Why Is the FDA Attacking a Safe, Effective Drug?
Ivermectin is a promising Covid treatment and prophylaxis, but the agency is denigrating it.
By David R. Henderson and Charles L. Hooper July 28
Search-up the underlined phrase – other non-pay sources.
@David Anderson Hey, David! Pardon the nosey question (and don’t answer (or just say “no”) if you feel it is a personal question), but are you the same David Anderson who is has written an excellent book on Hongshan culture artifacts?
“Here’s what the latest fuss/panic is about.”
http://www.smalldeadanimals.com/2021/07/30/covid-2-0/
New terms from comments there
“Cerbians and VAXXOIDS”, ““Profijuice”, “Profitvax” & “VidVax” to that new section in the Vid Dictionary..??”
One way of looking at it
You’re probably not suprised
“Biden Administration: If we don’t like a court order, we’ll just stonewall it”
https://bayourenaissanceman.blogspot.com/2021/07/biden-administration-if-we-dont-like.html
Hummm,
https://www.documentcloud.org/documents/21030483-outbreak-of-sars-cov-2-infections-including-covid-19-vaccine-breakthrough-infections-associated-with-large-public-gatherings-massachusetts-july-30-2021
CTH on that
“CDC Study, Most People Infected With COVID During Massachusetts Outbreak Were Vaccinated, 74 Percent of Outbreak Within Vaccinated Population
July 30, 2021 | Sundance | 13 Comments
https://theconservativetreehouse.com/blog/2021/07/30/cdc-study-most-people-infected-with-covid-during-massachusetts-outbreak-were-vaccinated-74-percent-of-outbreak-within-vaccinated-population/
It’s Alex Jones, so prepare for shouting and OTT energy. OTOH, I’ve noticed over the years that, very unfortunately, most of the “Absolutely Crazy Talk BS Crazy Crap” he has claimed, has, now, in fact happened. I really really wish that were not true, yet it is.
So dial back the presentation from 120 dB to 65 dB and maybe there’s something valuable in this. At 16 out of 24 minutes he still has not said anything about the internet, it has all be about the Chinese Wuhan Covid crap. But he seems, from what I’ve heard, to be “spot on” with the science behind it all. Only “reach” has been that the Chinese Crap will cause an autoimmunity reaction to a protein in humans causing sterilization. That is, as far as I have been able to find out, only a “theoretical”. Yet it is a possible…. Do we wait for 70% of the population to manifest the result before we consider it possible?…
https://odysee.com/@AlexJonesChannel:c/BIden-Officially-Annouced-Internet-Kill-Switch:9
E.M I do similar gravy for bangers and mash too. :)
Beth
Remember Emile Mercier (cartoonist)
https://en.wikipedia.org/wiki/Emile_Mercier_(cartoonist)
and the tins of gravy? I haven’t found an example of gravy but this seems close to now!
E.M. Here is a more technical paper about the vaccines, how they function, what was released about them from the very limited animal studies, and how the predictable harms are now manifesting. You will follow it far better then me.
Click to access Pfizer-pharmacokinetics-and-toxicity.pdf
The True Nolan, I am not the true author of that book. (-;
Born in the mid 1950s, David was an extremely popular name. My wrestling team in high school had six David’s, all starting at different weight classes.
Does anyone know if the COVID tests record what cycle number the positive appears?
Another detailed take ( open letter to WHO) on the failing vaccines. And it is very pessimistic, yet instructive.
Click to access 28d8fe_266039aeb27a4465988c37adec9cd1dc.pdf
Sorry links failed.
1st. https://doctors4covidethics.org/wp-content/uploads/2021/07/Pfizer-pharmacokinetics-and-toxicity.pdf
2nd. https://www.globalresearch.ca/is-the-surge-in-covid-19-cases-among-the-vaccinated-attributable-to-the-virus-or-to-the-vaccine/5751240
Another Ian, that’s a source of humour I missed somehow, but I can see he’s funny. Think comedy’s going to be a lost art in future, what with woke and trigger warnings etc.
David A says: 31 July 2021 at 6:26 am
That first link to the analysis of the Pfizer study is shocking.
Money before safety.
I am reading through that first paper. To me, it seems a bit biased in that where it mentions toxicity, I’d have said potential toxicity. Dose matters, and this paper does not mention dosage. While LDL does matter for cellular distribution of cholesterol, that one is also made locally.
The paper is correct about complement. That chemical is a major factor in inducing vasculitis, that is, an inflamed blood vessel and clotting which may result in diffuse intravascular coagulation (bad) or thrombosis (may be bad, depending on how much and where).
@ ossqss https://chiefio.wordpress.com/2021/07/23/w-o-o-d-23-july-2021/#comment-148225
So only a few vaxxed infected people were hospitalized and none died.
I’m sure the mRNA vax carries with it some toxicity and this will vary per individual. But vaxxes peaked on 4/15/21. But excess deaths peaked on 1/9/21. About 150 million people have been vaxxed. If the vax was that bad, I think we would be seeing a lot more real world evidence of it, but we aren’t.
https://ycharts.com/indicators/us_coronavirus_vaccinations_administered_per_day
https://www.cdc.gov/nchs/nvss/vsrr/covid19/excess_deaths.htm#dashboard
The item being discussed is not a vaccine. It is technically a synthetically derived gene therapy.
It is also being used under an emergency authorization and has yet to be formally approved by the FDA for any application.
England, delta variant, look at table 4
https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/997418/Variants_of_Concern_VOC_Technical_Briefing_17.pdf
Number of unvaxxed (53822) is about double the partially/completely vaxxed (27192) cases. Number of deaths is 70 for partially/completely vaxxed and 44 for the unvaxxed.
That is another thing that grinds my gears a bit. People throw the word toxic around like it is something absolute. It isn’t. Toxicity will exist only when and where all of the necessary and sufficient conditions exist. Likewise, safe/safety are not absolute, either; for the same reasons.
ossqss – I think gene therapy involves the modification of an organisms DNA. mRNA vaccines don’t modify our DNA. It utilizes messenger RNA which is translated to proteins via ribosomes which exist outside the nucleus of the cell.
@David Anderson Not the author? Ah, too bad — it’s a very interesting book! As for the name “David”, yes, a popular name. My brother is another David, born in 1949.
Dr. John has a new video about the leaked CDC powerpoint. https://www.youtube.com/watch?v=XsRdICFRHcc You can draw your own conclusions whether mask requirements will continue forever, but what it says to me is that the “vaccine and only the vaccine” strategy was a very poor decision. It could have been vaccine PLUS IVM, and maybe that will be the consensus in some future decade. The vaccine prevents you from getting sick but it still lets the virus live in your nose long enough to spread it. According to this ‘leak’.
Meanwhile, the leak about the Pfizer contracts is more fuel for the fire.
https://americasfrontlinedoctors.org/frontlinenews/information-security-expert-on-revealed-pfizer-agreements-theres-good-reason-pfizer-fought-to-hide-the-details-of-these-contracts/
YMMV – the unfortunate fact of the matter is the Trump administration wanted to guarantee the companies would be protected in order to induce them to undertake the expensive development of the vaccines.
Jim2 please consider to read the two links.
Click to access Pfizer-pharmacokinetics-and-toxicity.pdf
https://www.globalresearch.ca/is-the-surge-in-covid-19-cases-among-the-vaccinated-attributable-to-the-virus-or-to-the-vaccine/5751240
The vaccine incident reporting agencies are there for a very good reason.
Some give a blanket dismissal to the affect of “ they are not necessarily connected to the vaccine… Yet far fewer incidents have been cause to the shut down of vaccines in the past. These agencies exist to monitor adverse reactions. The vast majority of the reports concern sudden occurrence of serious to fatal illness/reaction with no prior symptoms or history in the patients. As it turns out the kinds of incidents happening were warned about and predicted as potentially occurring! So far about 40,000 deaths and a couple of million adverse incidents. There is growing evidence that the vaccines are producing mutations that resist the vaccine. I understand that virology 101 warns not to introduce leaky vaccines in a pandemic. Apparently the delta variant is very contagious, and the South American “ lambada” I think, is both very contagious, and possibly more severe.
Delta appeared in India after only a few million vaccines, yet both variations , and more to come, are likely vaccine stimulated mutations. There is some good reason to be concerned that vaccine booster will be even more harmful. Also cases in the NH crashed this time of year before as well. ( not saying that the vaccine don’t reduce infection and severity initially, just pointing out that in the latest wave we had vaccines, seasons, and greater natural immunity all working together.)
The first link details the problem with a global administration of leaky vaccines, especially to the vast majority under little threat from the virus. For the reasons outlined in the link, the leaky vaccine may very well destroy the excellent chance for herd immunity that existed from naturally acquired far more broad scoped and durable herd immunity. Not to mention the possibility of ADE this fall -winter. The nations furthest into the vaccine are having the greatest problems.
BTW, does anybody know it the Covid tests record at what cycle the virus is detected?
@ cdquarels, you want toxicity, see https://chiefio.wordpress.com/2021/07/28/toxic-femininity-and-toxic-crt-the-counter-revolution-underway/
Lol
Beth
More – http://www.cartoonists.org.au/stanleys/halloffame/mercier_emile
His take on the mayoral chain of office was made of empty sardine tins linked together.
“Maskapalooza”
“Good podcast here explaining the uselessness of masks.”
http://www.smalldeadanimals.com/2021/07/31/maskapalooza/
Ok, here ya go. A simplistic review of the pandemic from my shoes.
Last year, 2020, probably early/mid February, my sophomore son got sick. Did a doc visit, no flue from the test, so we proceeded accordingly. He was symptom free after about a week as I recall. Wife got sick for 2 days, and done. I felt a fever for about an hour, and done at about the same timeframe. Nothing more
Last weekend, had about 6-7 friends of my son, who had all gotten the Jab.
He subsequently got cold symptoms about a day later, then me a day later. Wife is up north, so that ob was not available.
Hence, he got through things in a couple days. I also fought symptoms of a sinus infection with my usual Vicks nasal spray that burns like hell, been using it for the last 7 years if I feel something encroaching in the nose, to a 100% no Doc needed success rate so far.
Use of the spray, and things are back to normal. I do believe we had the Delta, but not going to waste the time to do a weak test for such as I still probably have the antibodies from last year that trained my T cells etc..
Anyhow, who can ID why the “burn you nose out” spray works for me? Just sayin, it has worked consistently after years of visits to get meds which had the same result. No BS, every time.
Well that was not what I wanted to post, message to the editor, but it is what it is. LOL
This is what I meant to put up. LOL :-)
Canada but – –
“Three Reasons A Liberal Win Would Be Good For Conservatives”
http://www.poletical.com/10-reasons-liberal-win-good-for-conservatives.php
““Off Target”: Bad Economics of the Climate Crusade (mitigation not supported by mainstream analysis)”
@Ossqss:
I’ve had many times now (over 1/2 dozen) when I’ve gotten the “burn in the nose and tickle in the throat” and then 100% of the time ivermectin has had it gone. I’m certain, by this time, and with not one, but TWO cross country driving trips with nobody doing masks to speak of from Nevada to Florida and back, I’ve been fully exposed and my immune system now knows what this bug is.
Latest was today. In Walmart, the guy in front of me wearing a Veterans Hat and about 75 yo, wants to talk. As the line is oh so slow, this lasts about 20 minutes. He’s maybe 2 feet from my face, neither of us is with a mask on. I have one in my pocket and think about it, but … it’s already a bit late. As I left the store, I felt an odd “tingle / tightness” start to develop in the lungs and nose. That feeling of “something trying to move in”. If faded about 2 hours later. But just now returned with a bit of a vengeance as I’m sneezing and blowing my nose like crazy (common for me in an allergy or immune response as I have OTT immune function).
So, OK, if feels like my lungs are cleared mostly and now it is just down to the nose. Tomorrow is my regularly scheduled once / week Ivermectin dose, so I’m thinking of doing it tonight. What’s 12 hours to a once a week dosing plan…
I have every confidence this is going to be Just Another Nothing in a list of about 1 / month for 1.5 years. It’s also possible that it is a 12 hour delayed response to mowing the weeds in the garden and the back yard. BUT usually dry grass and weeds cause an immediate reaction, not a delayed one. Whatever.
For whatever reason, I’ve had MANY such “exposure / burn-tickle” cycles and they all end up “over and done in a day”. Infections, to me, feel qualitatively different than just plain allergies ( I’ve got 68 years of experience with both now…. or maybe 69… I’ve started to lose count ;-) and most of these have felt like “bug trying to move in” and then it’s just gone next day. I credit the ivermectin.
My guess is that either the guy was “fully vaccinated” and spreading spike proteins from that, or more likely is a Delta Variant carrier and I’m once again being the crash test dummy for Ivermectin.
In Theory, we are once again a Hotbed for the “India Delta Variant”. But really, who knows. The data are so corrupted by methodology changes and “just guess it’s OK but if you guess Covid you get $30,000” and more as to make it all trash.
But really, riddle me this: How could I have spent about 1.5 years running around one of THE earliest spots of “Community Spread”, cross the country 2 x on driving tours, not use a mask almost all the time other than at work, been in a crowd of about 1/4 million or so, and NOT have been exposed to it? The odds become outrageous.
Whatever.
I’m going to go slather myself with Cattle Drench a day early and watch some OLD tv shows or movies. No need to bother with any new “Woke Crap” movies or “Woke Crap” TV shows…
As it is, it feels like the nose is settling down now that it’s cleared out whatever was bothering it. Throat still feels a little bit scratchy though….
FWIW – Blood clots 2007
Link at
https://joannenova.com.au/2021/07/weekend-unthreaded-371/#comment-2449427
E.M.
If you needed any more reasons to relocate –
“Bacon May Disappear in California as Pig Rules Take Effect”
https://www.breitbart.com/news/bacon-may-disappear-in-california-as-pig-rules-take-effect/
“E.M I do similar gravy for bangers and mash too. :)”
EMS & Beth: try replacing milk with a dash of red wine and water – about 10% wine. Make sure you simmer enough to boil off the alcohol. Best part is, you can drink the rest of the bottle with the meal :-)
Re no bacon in California.
The linked article said prices for bacon would rise about 60%. I’m thinking that all that bacon that used to go to California has to go somewhere, and I expect lower prices throughout the country.
The article also mentioned that California might give Iowa hog farmers a pass while the bring their operations into compliance. I think that is the more likely scenario. To my experience, Asians favor pork, chicken, and seafood over beef and there are a fair number of Asians in California. I think lawmaker will be pressured to give pork producers a pass.
But it is California after all, and they still have a few toes they haven’t shot off yet. Maybe California will go ahead and enforce the ban.
.
.
Maybe it’s time for us carnivores to get vegetables banned and force everyone to eat meat. So long as some people insist on forcing their preferences on others, may all of us ‘others’ should do likewise.
I just noticed something odd about one of my coffee cups. It is a right-handed coffee cup.
It’s not that way due to the shape or handle, but due to the graphics. There’s a giraffe printed on the front. If you drink your coffee right-handed and you tilt the cup to take a swig, printed a bit below the rim opposite your eyes is a cutesy “What’s up?”
If you use the cup left-handed, you never get to see the tag line.
Do you think there’s a lawsuit lurking in there somewhere for discrimination against lefties? People have sued over less.
😜
Kneel, that gravy sounds good to me, will do!
@Another Ian:
Not real worried about the bacon (or the rest of the pig either…). It WILL add to the increased costs of stuff in California, but that’s about it. We went through this with eggs too. Farmers and packers waited to the last minute, screamed all the way; then just made the cages larger and such.
IMHO, worst case is that we get a sudden rise in pig farming operations in California as some folks take advantage of the price jump, and then it will settle back as Iowa comes back on line.
FWIW, I’ve toured pig farm operations, in the Midwest. This isn’t rocket science. You have a large simple barn (like a giant shed, really) typically with concrete floor. Metal fencing divides it into pens. There’s a HUGE corn & soy hopper on the end, and automated delivery of corn to feeders and water to watering troughs. Every so often the floor gets the pee and poop washed off (this can be via a floor with lattice work letting it just drop through, but what I saw was just water sprayers. One automated one manual. Piglets start at one end, and as they grow, are moved into the next batch of larger spaces. Eventually they leave at the “mature” end.
Separate from this is a breeding pen facility for creating the piglets. That’s were this law has an impact from what I can tell. So, OK, farmer has to hire a couple of guys on a weekend to move the fencing around and make the breeding pens bigger.
Note that typically the actual hog barns are a small part of the total operation. There’s often a HUGE pig poo handling operation. Some places ferment it it to get methane gas to power the whole place. Others dilute it and pump it to sprayers that put it on a field (sometimes where they grow the corn & soy fed to the pigs…). Etc. It is a big part of the operation. Also note that the percent of land in the pig barns compared to total corn land used to feed said pigs is “small”. There’s a LOT of land available around the pig barns to make them a little bigger.
Personally, were I running a pig barn operation, I’d just add a new breeding barn compliant with California, put a brand on each piglet from it (ear tag) and charge extra for them. It isn’t like the sow kicking out 10 to 14 piglets at a time several times a year is a big physical area of the farm. All those piglets as full grown ready for market are going to take up far more room.
PITA to the farmer? You bet. Some of these operations have a guy in a truck who visits a couple of times a week just to make sure the automation is still running right. A contract corn supplier fills up the corn hoppers on a schedule and all the other stuff is automated with sensors to holler if something broke. Labor cost most of the time from piglet in to product out is very very low. Now he’s got to disrupt that money machine to reconfigure part of it? Hire a couple of guys and figure out where to get the extra room? Royal PITA as he’s already booked up every day.
That’s why I’m saying I’d just build a new California Ready facility. 1) Identify or buy land. 2) Call contractor and set schedule. 3) On completion, add pigs & have first corn/soy delivery.
Would I rather this disruption was not happening? Sure. Am I worried? Nope. Am I happy at the idea of higher bacon costs? Not really, but not high on my list of concerns either. The $9 Fish Meal from MacDonald’s yesterday is more concerning. We’re about to break the $10 / fast food lunch barrier… It was a $5 barrier about 15-20 years back. That’s a very fast double… Ordered my usual “2 Breakfast Jacks” a few days back from Jack in the Box (I now avoid ALL fast food places, but spouse periodically insists on wasting money…). Not only were they $2.xx where not that long ago they were under $1, but the whole thing seemed smaller. Bottom bun was maybe 3/16 inch thick, top bun a bit over 1/4 inch, ham on it paper thin. I think they have gone to the smallest egg you can buy too. Next time I’m out of State I’m going to order one and take measurements. (A couple of years ago I had a KFC meal in Georgia and I swear the parts were larger there, smaller in California…)
Whatever. “Inflation will continue until the money improves….”
Add some to the cost of bacon and it will just melt into the overall insanity of runaway inflationary pressure.
As far as symptoms go, I’ve had asthma since about 12 and hay fever. I’m used to head and chest symptoms and have meds for it. I live with those symptoms, and on that note EMS, if you have hay fever, Florida would probably be a better choice than TN. TN has all kinds of flowering plants and grass, not to mention forests with dead matter feeding mold. At any rate, I don’t get head aches or generalized joint aches (but do have some arthritic joints). I get a flu shot every year and haven’t had the flu in decades. I got the COVID jabs, but as far as I can tell in the sea of normal symptoms, haven’t gotten COVID either. The vax for me was a non-event with a bit of sore shoulder, but otherwise SOP. I’m not wearing masks or isolating.
The biggest concern in my view isn’t vax toxicity, but ADE. Since the clinical trials weren’t carried out for 2-6 years, we just don’t know the answer to that one. As a backup, I do have and won’t hesitate to use IVM if I feel it necessary.
@Jim2:
We plan on renting in Florida first, then doing a trip to TN in about May to assess the allergy issues. Only after that will a “Buy” decision happen.
FWIW, that;’s why I think the decision to get vaccinated MUST BE PERSONAL. Every single person is different. This is an EXPERIMENT. There ARE deaths and damages associated with it, and nobody knows how much. That can not be mandated and have a moral society.
So, for a large (but unknown) number of people (and perhaps even a big majority percent) I expect No Bad Thing. (Though what I expect is worthless… nature will have the last word). The vaccine will work more or less for a while, “vaccine escape” will push to new variants where it won’t work, and things will “move on”. Pfizer is already saying “booster shots” and vaccines adjusted for the variants are needed…
However… There will be classes of folks where the damage happens. This happens with ALL vaccines, only the degree of damage and number of folks hurt changes. What makes THIS vaccine different / more risky? First off, any experimental drug is SUPPOSED to have 100% tracking and reporting of adverse events and we are not tracking them at all in any significant way. Willfully and organizationally blind.
1) NO long term data on safety. Remember thalidomide… We have no idea what this experimental drug will do over years. Might be nothing, might be horrible. Can it cause spontaneous abortions? So far the evidence is “Yes, but not in huge numbers” – but if YOU are the one… Will it cause health issues in the next generation? (Some drug effects show up in the children of those who took it…) Nobody knows. Will the blood clotting and immune provoking KNOWN ACTIONS cause damage that results in more death, dying, and injury in later life? We know the answer is “Yes for some” as the damage is already shown, but don’t know “how many”.
2) ADE. This has onset when antibody levels DROP to “low but still there” levels. With governments and Pfizer both pushing for “boosters”, this could be kept a few years in the future. It might be a global extermination event if it takes, say, 4 years with boosters before folks decide the vaccine treadmill isn’t working and stop. (Or in the paranoid case, the Globalists then withhold the boosters from non-compliant and / or “less desired” populations). On the plus side, we’ve not seen any evidence of ADE in the early test group (yet…) so it is possible we will dodge this one. (Or maybe not… so it must be a personal choice).
3) Auto-immunity. IMHO, we’ve already seen examples of this developing some time after the injection. A very few mostly older folks (so far, but several young women have died too) look to me like they have had a cascade failure of autoimmunity and died. In particular, I think that happened to Robert Felix who ran iceagenow.info (but note I’m no M.D. and I’m guessing based on what was stated publicly) along with a couple of others that I know of in the news. There are known similarities between some human proteins and some of the viral protein targets in the injection. This really needs a full study. There’s an unknown number of folks who just “up and die” within weeks or months of the shot, and IMHO a good number will be shown to have this problem. (One M.D. made a show of his “vaccination”, then died…covered in the media). This is often raised in the context of the placental protein that is similar and the potential for the shot to be causing miscarriages and eventual sterility. I’m more worried about my tendency to small auto-immunity issues (arthritis) and a hyperactive immune system to result in a catastrophic collapse scenario, thus MY decision to say no… and why it must be a PERSONAL choice.
4) Blood Clots. This is the one that seems to be killing more young women than the other problems. Especially young women on the pill (that already makes many women marginal to blood clotting disorders). It is KNOWN that the oxidized graphite “adjuvant” alone causes blood clotting problems (and makes up a large part of the shot). Then, looking at that large sheet of stable hexane / benzine rings with occasional “odd bits” of epoxy bonds et. al, on the surface: I can’t think of how in the world your body enzyme systems will dispose of it once in the blood. It’s an absolute alien molecule that we do not have systems designed to handle. (That it was researched and designed by a Chinese team does not give me confidence either… as they are under Government Guidance…) And the Adenovirus vector in J&J and Astra Zenica is also known to cause clots. All that changes is they cause more CVT in the brain while Pfizer / Moderna cause more in the liver. Both can and are lethal at times. So how much undetected damage is being done, eh? How many get a small clot that takes out part of the liver, but not all, or takes out the part of the brain that remembers how to do calculus but not enough to be hospitalized and folks just think they forgot? These shots muck up your blood chemistry big time and nobody knows how much damage is done. One M.D. lost his platelets and bled to death in the ICU… so it goes that way too.
Had this turned out to be the 20% killer with no treatments that we were sold in the early days, I’d have taken the shot already. Since it is now known to be under 1% lethal, almost all of it in elderly and frail folks who die of flu & pneumonia each year anyway, and with nearly no risk at all to those under 40 to 50: I no longer see the reason to take on Experimental Risks with an UNKNOWN substance that is shown to kill and damage a significant number of those who get it, especially where there are now several proven treatments. So I don’t.
Apple SmartNews. Schumer certified. Pelosi approved.
News From All Sides! SmartNews delivers high-quality news headlines and breaking news from top news publishers: NBC News, MSNBC, USA Today, TIME, The Huffington Post, Bleacher Report, Quartz, The Verge, VICE, VOX, AP, Reuters, Buzzfeed, Fast Company and more.
https://apps.apple.com/us/app/smartnews-local-breaking-news/id579581125
@JIm2:
Oh Joy… /snark; just what I’d expect from Apple. News narrowed to just “local” and with all pablum all the time, no distressing facts to bother your pretty head about…
@Kneel63:
Sounds like an interesting variation. Perhaps a bit like making “Red Eye Gravy” from ham. No milk in it either … Hmmm…. Red Wine Red Eye Gravy… now that would be an interesting way to start the day ;-)
@H.R.:
Per pork products: Note that the Hispanic Population of California is HUGE. A majority in many counties. Can you say Carnitas? Pork is a big part of the Hispanic diet. If any group will be a pressure group, that’s the one.
But like I said before, not all that hard to just make the fence a bit larger for the California pigs. IMHO this is just the Bitch, Moan, and Sue stage before they just comply with the law. Personally I take no interest in the law one way or the other. A bit nicer for the pig, but the pig already has it much much better than in the wild with predators, parasites, and searching for anything edible. OTOH, giving a sow enough room to move around a little is NOT a high cost item. The estimates on how much it will increase costs are bogus. The bulk of ALL the costs are feed and feed and water and feed. Then comes labor and power. Way down the list is “cost of dirt and fence”. THE reason so many hogs are raised in Iowa is that it’s much lower cost to haul the feed from Iowa to Iowa ;-) makes other places more expensive as hauling feed is a big cost item.
I fully expect that initially the law will be observed by the application of a little sticker saying they really did, honest injun, comply… Put up a fence big enough to hold a sow or two, with a feed bucket and a water trough. IF EVER a California Inspector flies out to Iowa and schedules an “inspection”, phone Jorge and have him move a sow to that pen while you meet with the inspector… and take them to the farm. Only after enough fines start to show up to make it cheaper to actually convert all the needed facilities, actually do the work…
Oh, and since said rules and inspectors do not exist yet, I’m certain all pork products will continue to flow into the State pending regulatory pronouncements and inspection rules for compliance. They will say “Comply!”, the farmers will say “With what rules?”, they will say, “Um, give us a few months”, Farmers: “OK”…, State: “Here’s the rules!”, Farmers: “OK… we are in compliance.”, State: “We are going to inspect!”; Farmers “OK… let us know when”. State: “Hiring a guy now!”, Farmers: “OK…”, State: “Real Soon Now!”; Farmers: “OK…” rinse and repeat… then maybe 2 years from now one guy (who has finished inspecting things IN California) will fly off to one farm in Iowa, find an isolated new pen with a sow in it, and fly home. Then some of the farms will start building compliant facilities…
Oh, and there’s a really nice photo of a typical Pig Barn at this link. You can see how large they are, the giant feed bins at the one end, and the farmed land all around it:
https://www.porkcares.org/americas-pig-farmers/our-farms/
Plenty of room to “add a California Room” off to one side.
Elsewhere on the page they say 67,000 now. Even IF the State has 10 inspectors and they inspected 2 / day, that’s 67,000/20 = 3350 days or (at 300 days / work year) about 11 years. Good luck with that. The State of California is NOT the US Dept of Ag.
So I think a whole lot of folks will just print up whatever the Thing Is and stick it on the package… Being more paranoid, I’d fence off an area and put both feed and water buckets in it to be ready to hustle a sow or two into it for the “inspection”. (Until then you can use it to isolate troublesome pigs or those that might have health issues, so not entirely a wasted space.)
@H.R. per Coffee Cups:
Nope. I have a “mustache cup” that is handed along with a few dozen company logo cups that are handed. It is common. Folks can look at the cup regardless of hand they use for the sip, so no damages are done.
I was curious about the graphene in vaccines. I can’t find any credible info stating they use graphene oxide. This is what I was able to find:
Here is a breakdown of the three COVID vaccines and their ingredients:
Pfizer Vaccine: The full list of ingredients for the Pfizer vaccine is:
mRNA, lipids ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate), 2
[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, 1,2-Distearoyl-sn-glycero-3-
phosphocholine, and cholesterol), potassium chloride, monobasic potassium
phosphate, sodium chloride, dibasic sodium phosphate dihydrate, and sucrose.
The Pfizer vaccine does not contain eggs, preservatives, or latex.
Moderna Vaccine: The full list of ingredients for the Moderna vaccine is:
Messenger ribonucleic acid (mRNA), lipids (SM-102, polyethylene glycol [PEG] 2000
dimyristoyl glycerol [DMG], cholesterol, and 1,2-distearoyl-sn-glycero-3-phosphocholine [DSPC]),
tromethamine,tromethamine hydrochloride, acetic acid, sodium acetate trihydrate, and sucrose.
The Moderna vaccine does not contain eggs, preservatives, or latex.
https://portal.ct.gov/Coronavirus/Covid-19-Knowledge-Base/Vaccine-Ingredients
Does anyone have any credible information that contradicts this?
Austin defunded the police. Here’s the result …
The cuts have left the Austin Police Department with far fewer resources to solve crimes across the board. Police have left the force in record numbers, some taking early retirement, others finding other work — any work, as long it’s far away from Casar and Adler.
Austin just passed its entire 2020 homicide total with its 49th homicide of the year. It’s August 1st.
https://pjmedia.com/news-and-politics/bryan-preston/2021/08/01/adlers-disaster-austin-surpasses-grim-homicide-milestone-n1466245
@Jim2:
From that PJMedia / Austin link:
“The vast majority of Austin’s homicide victims have been minorities. Due to the cuts, their killers may never be arrested.”
Now I get it! The Democrats have always been pro-slavery and anti-black, they just dressed up in sheep skins since about the ’70s to try and hoodwink the Black community into voting for them (and it mostly worked). But here they have a way to claim to be “pro-Black” via not letting police stop crimes, AND kill off more Blacks and Hispanics in the process. “Win-Win” from their warped POV…
I haven’t seen this before
“No – the Chinese FGOALS model has the lowest trend and is close to the CMRW model:
https://1drv.ms/u/s!Aq1iAj8Yo7jNhBlQt8jdeBoZ9NhY
Most comparisons of models show the anomaly. In this chart I have used the actual temperature output of the models. As far as the Chinese model is concerned, there is no global warming. Global warming has become a powerful political tool whereby China encourages the west to respond to their model output while China will retain business as usual in response to their model output. It is working out very well for China.”
https://joannenova.com.au/2021/08/jet-streams-playing-havoc-bringing-snow-to-brazil/#comment-2449307
Right, EMS. The Dims also stand by and watch while antifa burns down black businesses.
On Friday, three prominent black supporters of President Donald Trump condemned Democratic nominee Joe Biden’s record on the black community in a press call. Trump campaign Senior Advisor Katrina Pierson, Georgia State Rep. Vernon Jones (D), and former NFL player Herschel Walker each claimed that Donald Trump “has done more for us in 47 months than Joe Biden has done in 47 years in public service.”
https://pjmedia.com/election/tyler-o-neil/2020/10/16/vernon-jones-antifa-are-burning-black-businesses-and-nobody-holds-joe-biden-accountable-n1064598
With friends like those …
Have a guess at the “pucker factor”
LEAKAGE!
“Exclusive: Bipartisan So-Called ‘Infrastructure’ Bill 2,700 Pages Long”
https://www.breitbart.com/politics/2021/08/01/exclusive-bipartisan-so-called-infrastructure-bill-2700-pages-long/
Rerun! “To find what is in the bill you’ll have to vote for it”
Very good video concerning the psychological reasons why such a large part of our society have accepted the COVID official scenario, in spite of the obvious problems with statistics, numbers and explanations.
https://www.bitchute.com/video/LBcZY6GAZIYj/
I have a good story for a change. An older lady we know was exposed to covid and tested. The test came back negative, but then she started feeling sick. Her doctor prescribed IVM very quickly!! I was pleasantly surprised.
Also, she had had the J&J vax.
Maybe this is why some people believe graphene is a component of the covid vaccines. The graphene is used in a test kit, not in the body.
Graphene Leaders Canada (GLC), along with its subsidiary GLC Medical (GLCM), has developed a graphene-enhanced sensor, for use in a rapid Covid-19 test.
The new graphene-enhanced sensor has been designed to support the Rapid Covid-19 Virus Detection Test Kit, which provides results within seconds.
GLCM’s graphene-enhanced sensor transmits a signal when exposed to the viral antigens, unlike other test which detect the byproducts of infection.
GLC-GLCM indicated product development lead Jason Deacon said: “Graphene is the ideal sensing material. The 2D nature and conductive attributes of graphene make for an extremely sensitive material to detect any molecule. I have investigated this principle extensively during my time at Cambridge University.
“At GLC-GLCM, we have made the surface highly specific to SARS-CoV-2 (COVID-19) to ensure that our rapid test will save lives. The study of 2D materials has been encased in academia for 15 years. Our team at GLC-GLCM believes that nanotechnology regarding 2D materials is critical to future technology and innovation, with graphene at the forefront.”
https://www.nsmedicaldevices.com/news/graphene-sensor-covid-19-test/
jim2 says: 1 August 2021 at 5:49 pm
” I can’t find any credible info stating they use graphene oxide. ”
You then go on to quote the Pharma companies as if they credible sources. LOL.
Whether you consider Karen Kingston, a former Pfizer employee to be credible is up to you.
https://rumble.com/vkgdq7-deadly-shots-former-pfizer-employee-confirms-poison-in-covid-vaccine.html
There has been mention of 2 separate groups of researchers finding graphene in the Vaccines, not the test kits.
If I come across them I will post them.
Latest issue
https://bayourenaissanceman.blogspot.com/2021/08/memes-that-made-me-laugh-69.html
ACO – I’ve taken a quick spin through the documents presented. Not one I’ve seen ties the vaccine to graphene. She presented the same information I did, and then presented research papers into graphene that have nothing to do with vaccines. She isn’t a medical researcher, she appears to be a stock analyst. I will take a longer look later, but for now, I give the effort an F. Maybe she’s trying to manipulate the stock for profit??
So the first document presented is supposed to be a Moderna patent for graphene in a vaccine. I can’t see the whole thing, so “supposed.” I wouldn’t be surprised to find such a paper from Moderna. Graphene is a hot topic in many areas of science and later in the video, they show research papers in fields other than medicine. But the really critical thing here is this paper does NOT say graphene is present in the current mRNA Moderna vaccine. The mere fact that Moderna has a patent relating to vaccines and graphene does not logically imply it is in the current vaccines. It does show they have an active research department. None of this is a surprise to me.
Here is the first paper presented. Show me in it where graphene is even mentioned. I think we are being gaslighted.
https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/997584/COVID-19_mRNA_Vaccine_BNT162b2__UKPAR___PFIZER_BIONTECH_ext_of_indication_11.6.2021.pdf
jim2 reminds me of two Democratic leaning Lawyer friends of mine. When I point to obvious voting/counting fraud they both state that there can not be any voting fraud because it is against the law.!
As to the Graphene in “the shot”, It was discovered by by laboratory researchers in Spain that were examining sealed vials of Moderna. They had not yet worked on and reported on Johnson&Johnson as of last week. Of course it is not listed as an ingredient ! That would be against the law.
Perhaps “gaslighted” by both sides…
Clearly there’s a lot of hype in the “It is poison” position (and Stew Peters is prone to hyperbolic statements and technical inaccuracies… like leaping from “lead pencil” to graphene is lead…).
Just as clearly the Big Pharma companies are hyping the shot tremendously. It is a mediocre vaccine that is highly leaky and has a very high lethality and injury rate compared to all other approved vaccines.
The presenter on the Stew Peters show seems to make a decent case that you can track a chemical number from the MSDS, but seemed to have a couple jumps where there ought to have been a bridge…
At this point, I’m not sure what is, or is not, in any of the several vaccine concoctions. But the fact is some billion scale of people have been vaccinated and they are NOT dropping like flies. So clearly it isn’t prompt toxic in the extreme. That leaves very very slow toxic, and minor toxicity as the options for the paranoid side. Not a lot of stuff is very very slow toxic…
My biggest concerns are the potential for ADE in a year or two, and that the vaccine, being leaky, will select for a hyper virulent and more damaging variation:
https://www.pbs.org/newshour/science/tthis-chicken-vaccine-makes-virus-dangerous
Seems to me that we’ve now done that study. A gigantic human population was vaccinated, the virus mutated, and now we have vaccinated superspreaders spreading it around the world as it becomes the dominate strain. Oh, and one news report said ~”10,000 time as much virus in their nose and throats”… so that matches too.
So my guess is that this is not going to end well…
Here is a good example of fearmongering and lying with numbers — and all done with a smile and a glim in her eye. There are so many things wrong with it. A 99.999% survival rate for vaxxed is a 1 in 100,000 death rate. HURRAY! Those stupid unvaxxed are 25 times higher — 1 in 4,000. But VAERS says that there are currently 5,902 reported deaths from the vaxx, about 1 in 30,000 — but it may easily be (if the Harvard studies are correct) an order of magnitude higher, at 1 in 3,000. Who would take a 1 in 3K death chance to save themselves from a 1 in 4K chance? (And of course, why trust their numbers, what about using Ivermectin, what are the long term effects of the vaxx, etc., etc.)
@E.M. “but seemed to have a couple jumps where there ought to have been a bridge…”
I just have to comment — really NICE phrasing. I may steal that for my own use.
RE the creation of new and more deadly variants because of leaky vaccines:
https://www.geertvandenbossche.org/post/a-last-word-of-caution-to-all-those-pretending-the-covid-19-pandemic-is-toning-down
“The current expansion in prevalence of infectious Sars-CoV-2 variants is highly problematic because it erodes natural Ab-based, variant-nonspecific immunity in the non-vaccinated part of the population. The high infectivity rate that results from this expansion not only further enhances the expansion of these variants but may also drive natural selection of viral variants that are featured by an even higher level of infectiousness. Erosion, therefore, of natural Ab-based, variant-nonspecific immunity promotes breeding and transmission of more infectious viral variants in the non-vaccinated part of the population. On the other hand, mass vaccination promotes natural selection of increasingly vaccine immunity (VI)-escaping variants in the vaccinated part of the population. Taken together, mass vaccination conducted on a background of high infectivity rates enables more infectious, increasingly VI-escaping variants to expand in prevalence. This evolution inevitably results in inclining morbidity rates in both, the non-vaccinated and vaccinated population and precipitates the emergence of circulating viral variants that will eventually fully resist vaccine-mediated immunity (VMI). This is why mass vaccination campaigns should not be conducted during a pandemic of a highly mutable virus, let alone during a pandemic of more infectious variants (unless transmission-blocking vaccines are used!).”
PGS – I’m just asking for better proof than some woman on the internet, that’s all. I’m open minded about it, but this isn’t Disney World.
If we had an honest medical research broker, I believe they could model potential variants. It may be that the electro-chemical (the arrangement charged regions of the protein) of “shape” of the spike might never be able to get different enough to form a serotype different from the one we now have.
Or maybe they could show there would be one that likely would form a new serotype. If this is the case, then ADE become much more likely. And that’s the kind of information that would be useful.
For now, I’m sticking with Ivermectin. It seems to be effective regardless of the variant (so far!)
I have not heard and update on the TB (?) vaccine used for Covid & variants. I thought there was supposed to be approval or rejection in July, but July has come and gone.
I only saw one or two, non-scientific blurbs about the vaccine, but what interested me is that it was a vaccine and not some mRNA therapy. I am only guessing here, but I was figuring it messed with FauXi’s Flu in a manner similar to Ivermectin.
I do not think it is still possible to ascribe the events of this “pandemic” to ignorance, poor planning or lack of resources. This is cold blooded genocide. Please watch this interview discussing the background of the officially approved COVID treatments, and prior knowledge of expected adverse effects of the “vaccine”. This is worse than I imagined.
https://market-ticker.org/akcs-www?singlepost=3682364
“it is now known to be under 1% lethal, almost all of it in elderly and frail folks who die of flu & pneumonia each year anyway”
DarkHorse Podcasts speculates that maybe ALL deaths from Covid were of people who had comorbidities:
(BTW, DarkHorse is putting everything on Odysee now and just putting teasers on YouTube which direct viewers to Odysee.) Because YT censors and demonetizes. The social media GEBs are Evil.
https://dilbert.com/strip/2021-08-01
A reply to a question on how were countries with high HCQ use going now as they don’t seem to get mentioned –
“Nigeria has been discussed – they have issues with both malaria and parasites and guess what? VERY low incidence of CoViD”
Re the parallels with Marek’s disease … luckily those of us reading this blog don’t have to live in the same conditions as battery hens. You have to wonder whether the new strains of virus induced by the leaky vaccine were only so lethal on account of the fact they affected birds forced to live in battery conditions.
I keep wondering whether Covid-19 itself would ever have been such a threat if we hadn’t fallen for the Chinese Communist Party’s advice to deny old and vulnerable people access to fresh air, sunshine and exercise. Oh, and to strap a mask across their face to force them to re-inhale exhaled germs. There is so much evidence that the virus was circulating from at least autumn 2019, yet it only started killing people in spring 2020, once those vulnerable people had bolted their doors and refused to come out.
In fact, I sometimes wonder whether the virus itself is no more than a mind game originating in Peking. Bear in mind that the genome of this virus was handed over by the Chinese with remarkable speed. Would it be possible that they fabricated a description of a virus containing bits and pieces corresponding to already circulating SARS-1, corona, and influenza viruses? So that when samples of those viruses are passed through a PCR test at very high cycle threshold, they’ll eventually be found to have an element corresponding to this CCP-described virus, and, hey presto, it appears to exist.
In other words, maybe SARS-2 is just a malicious exploit of the PCR test!
“UNCOVERED EMAIL SHOWS MILWAUKEE ELECTIONS EXECUTIVE WOODALL-VOGG LAUGHING ABOUT THE ELECTION STEAL ON ELECTION NIGHT”
https://richardsonpost.com/joe-hoft/22866/milwaukee-election-steal/
BUT
“Maricopa County Board of Supervisors Responds To Arizona Senate Subpoena – Go Spit, “It’s Time to Move On”
August 2, 2021 | Sundance | 127 Comments
https://theconservativetreehouse.com/blog/2021/08/02/maricopa-county-board-of-supervisors-responds-to-arizona-senate-subpoena-go-spit-its-time-to-move-on/ “
RE the older lady I mentioned @ https://chiefio.wordpress.com/2021/07/23/w-o-o-d-23-july-2021/#comment-148306
After two days of taking IVM, she is sounding very much better over the phone, a lot less sickly voice. I’m excited to know someone personally who has been given IVM for COVID. It appears to be working very well. And this after the J&J vax – so IVM works under that circumstance. Good news – but just a sample of one of course.
Covid ponderings
https://www.redpowermagazine.com/forums/topic/140072-a-post-covid-world-now/page/31/?tab=comments#comment-1589987
“Eric Weinstein: There’s Been a Complete Absence of Leadership Amid COVID-19”
Link at
http://www.smalldeadanimals.com/2021/08/02/anti-leadership/#comment-1477857
Just putting this here as a “note to self”:
Seems that Slavery is NOT just a White Guy thing after all…
https://en.wikipedia.org/wiki/History_of_California#Slavery
Interesting that the Whites in California didn’t practice slavery, yet the Native Indians did, and were allowed to continue it until the 14th Amendment…
@Jim2:
Nice to hear about an actual case / cure with ivermectin.
@Graphene Topic:
Note that is is know to be an adjuvant in vaccines. If looking up how to make the vaccine, they might not mention the adjuvants unless you dig for it. Rather like Aluminum and mercury were not “top of label”…
https://pubmed.ncbi.nlm.nih.gov/26814441/
From 2016, or 5 years ago. Plenty of time to make it to production status:
I note in passing the names all look Chinese to me.
PEG is part of the delivery system of some of the vaccines. Be on the lookout for “GO-PEG” as an abbreviated way of saying Graphene…
https://pubmed.ncbi.nlm.nih.gov/32531395/
So, yeah, China all right.
There’s a WHOLE lot more if you just look. My search term was “Graphine adjuvant vaccine”.
While this does not say or prove that any of the current vaccines contain graphene, it clearly demonstrates desire and intent to use it for the stated purpose in vaccines. How better to get past that whole 7 year safety testing than just use it in this “emergency”… So I’d not doubt at all that it could very well be in the stuff.
I’d also make sure you are looking for GO and GO-PEG and the particulars of their individual MSDS for the vaccine and any PEG used to see if it is hiding in the sub-constituents of the PEG used as “wrapper” in the delivery system.
With both a Dr. Dong and Dr. Wang I have to wonder if this is a Babylon Bee wanna-bee… or just an unfortunate set of names.
https://pubmed.ncbi.nlm.nih.gov/32070776/
Iranians seem a bit less enthusiastic about the whole idea:
I think I’ll pass on the graphene enhanced injections, thanks. Not even interested in the up the nose sprays. Happy to stick with ivermectin (or Quercetin / zinc / Vit-D & C if necessary)
To “upmarket” any discussion of ivermectin call it “stromectrol”
https://www.healthdirect.gov.au/medicines/brand/amt,3069011000036101/stromectol
FWIW
“CanadianPatriot77 Patrick King, Get his court Transcripts.
He Took Hinshaw and Alberta Health Services To Court and won.
Hinshaw could not produce medical or scientific facts to show that a VIRUS ever existed at all. No Legal Justification For What Hinshaw and Kenney Did.
Looking Very Bad. Transcripts of Case available.”
http://www.smalldeadanimals.com/2021/08/03/august-3-2021-reader-tips/#comment-1477945
Regarding Graphene E.M. comments;
Wow, classic E.M. search prowess! Well done. The reason why, after seeing your comments at WUWT many years ago, I came here to visit.
Remembering back then, I think “ all those troubles seem so far away, now it seams as though there here to stay”. Seeing what US deficit spending has been in the past decade, it is now apparent that 2010 levels of debt creation, could have continued for many decades without the feared collapse. CAGW then, while an obviously wrong political ideology, was not 1/10th as expensive and negatively impactful on everyday lives.
It is the success of modern industrial society that has given billions time, free time to follow their desires. And getting what one wants is often exceedingly harmful and wasteful. I first noticed this when I first began to work in the early 1970s. I was making good money then, an average of just under $8.00 per hour. I watched in amazement as young health men came into the trade, worked hard long hours for two weeks. Got off for five days or so, and destroyed their lives with drugs, drinking, fast times, and fast women. It became clear that money to follow undisciplined unwise desires, wasted lives. “ The ruins of liberty, abused to licentiousness.” George Washington.
Now in America we see something related on a national scale. Only the drug is power over others, with a prosperous society having immense free time, and equally undisciplined minds looking to save the world instead of order their own lives,
easy fodder for the One World Government bastards.
The purpose of the adjuvant in a vaccine is to be nasty enough to persuade the immune system that what it finds injected with that adjuvant is a serious problem and needs a big immune response. Thus for example using the blue blood of horseshoe crabs as an adjuvant, which is very alien to our systems. AFAIK the use of adjuvants was discovered by accident in the first place. Still, without them the immune system would mostly just swallow the virus and not produce the long-term immunity (memory cells, and antibodies circulating in the blood ready to attack the next virus that gets in).
Basically, the adjuvant needs to be pretty bad stuff. Most nanomaterials are a lot more dangerous than you’d think from the materials they are made from, because the surface area is so much greater and because monolayers of atoms have different electronic properties than the bulk material.
Graphene and other Carbon allotropes are a popular research subject. Worth noting that when Radium was discovered it was popular too, and manufacturers produced stuff like Radium toothpaste (makes your teeth shine…), make-up containing Radium, and Radium-infusers for water to make you healthy. We now see that as being misguided. It’s thus pretty much expected that people will be trying to use Graphene derivatives wherever they might possibly be useful, and they are nasty enough to be used as an adjuvant. Gooses up the body’s defences pretty well, and thus makes the body treat all the stuff it finds at the injection-site as being an enemy.
As noted in EM’s comment above, though, the long-term effects aren’t nice (and the long-term effects of Radium weren’t good, either). Might also result in auto-immunity, as a logical extension of treating all the stuff at the injection-site as alien.
The main problem I see with the vaccines is that they only deal with the viruses that get into the blood stream. They don’t stop replication of the virus in the mucosal membranes and so the virus can multiply there quite happily and get exhaled to infect others. This is a dangerous strategy. It’s selecting for a virus that evades the vaccine and is more transmissible, and is more-easily spread by vaccinated people. I don’t know whether they are in fact using GO as the adjuvant in the mainstream vaccines, though I’d expect that it has been tested (hopefully in animals and not yet human subjects). The long-term effects simply can’t be known yet.
It would make more sense to use a nasal spray as vaccination. That would after all stop the virus multiplying in the mucosa and stop onwards infection. Even there, though, the GO might be a step too far in adjuvants to make the immune system respond. As I see it, an atomic monolayer can probably slide through cell walls and reach places that larger particles can’t penetrate to, so pretty hard to predict the long-term results.
Why such a push to get everyone vaccinated, even the 12-year-olds, with a vaccine where trials won’t be complete for another couple of years? The risks are still unknown.
EMS – I did a search for graphene applications in medicine, but found only research papers, no actual in-use applications. I may take a whack at that later. But as you say, there is no evidence graphene in any form is used in the mRNA vaccines.
So, in all fairness, here is a guy who believes there is graphene in the mRNA vaccines. In my opinion, he is a nut job, but you can decide for yourself.
How to Detox/Get Rid of the Nanotechnology From Chem Trails & Vaccines in Your Body & Cleanse Your Pineal Gland
The problem with “graphene” is that is isn’t a well-defined molecule. It can vary by the number of carbons in a single sheet, so a huge variation possible there. There can be double or more layers. It can be chemically modified. So the combinations are virtually endless. The devil will be in the details. I did find this:
Myeloperoxidase — an enzyme naturally found in our lungs — can biodegrade pristine graphene
https://www.sciencedaily.com/releases/2018/08/180823113613.htm
i“La Quinta Columna wants to make it clear from the beginning that we have the obligation, we have the obligation to be united because we are in the same battle to give the best of ourselves, because what is at stake is precisely the future of all species. Depending on the strength and momentum that we put into this task will depend on the future of all humanity. We are right now at the turning point from which things can begin to change, and in this sense La Quinta Columna is going to summarize what has been the result of its research during this year and a half, but above all and especially during the last two months. And why during the last two months? I always remember Dr. José Luis Sevillano’s words since the two of us work as a binomial and he has been accompanying me in La Quinta Columna. He said that when the vaccination started we were going to really see what he was doing and what material could be in there.
Then we realized that there was a new phenomenon that for a while we tried to deny, although today it’s evident because of the millions of videos on social media, and we have been able to even measure it with devices: teslameters, magnetometers, etc. I am referring to the magnetic or pseudo-magnetic phenomenon that people acquire after inoculation. A magnetic phenomenon on the one hand, but also one that turns inoculated people into superconductors and also stores energy that can be measured with a multimeter in certain parts, such as the forehead, for example.
https://truthcomestolight.com/on-the-connection-between-graphene-oxide-found-in-covid-vaccines-electromagnetic-fields-blood-clots-severe-covid-symptoms-how-to-remove-graphene-oxide-from-the-body/
Hereafter La Quinta Columna shall provide you with information vital to your health, physical integrity and that of your environment.
The masks being used and currently marketed contain graphene oxide. Not only the ones that were withdrawn at the time, as indicated by the media, the swabs used in both PCR and antigen tests also contain graphene oxide nanoparticles.
The COVID vaccines in all their variants, AstraZeca, Pfizer, Moderna, Sinovac, Janssen, Johnson & Johnson, etc., also contain a considerable dose of graphene oxide nanoparticles. This has been the result of their analysis by electron microscopy and spectroscopy, among other techniques used by various public universities in our country.
The anti-flu vaccine contained nanoparticles of graphene oxide and the new anti-flu vaccines and the new and supposedly intranasal anti-COVID vaccines they are preparing also contain enormous doses of graphene oxide nanoparticles. Graphene oxide is a toxic that generates thrombi in the organism, graphene oxide is a toxic that generates blood coagulation. Graphene oxide causes alteration of the immune system. By decompensating the oxidative balance in relation to the gulation reserves. If the dose of graphene oxide is increased by any route of administration, it causes the collapse of the immune system and subsequent cytokine storm.
https://myquirkyfriend.com/do-you-know-what-graphene-oxide-is-you-should/
@Jim2:
Nice find on the enzyme to break it down. Would be nice if it is also in places other than the lungs, but at least there is some mechanism to clear the stuff.
The Spanish fifth column stuff (La Quinta Columna ) and the Chemtrails & Graphene guy do look a bit like nut-bars. They might have some useful information in their stuff, but any of it must be vetted. (Why? Anyone pushing themselves as a Fifth Column clearly has a political agenda to push and most of the folks bought into Chem Trails are easily confused by contrails and have a poor filter… but sometimes they find a nut…) So I’ll read those links over morning coffee (when my brain isn’t all that sharp either ;-)
One big red flag for me is the claim that it makes a body temperature “superconductor”… were that true the electrical grid (and most appliances) would be getting a major makeover right now ;-)
Part of the problem with a Literature Search is that the presence of GO can be left off of a lot of the write-ups if it is a “Trade Secret”. Furthermore, they can have the chemistry hidden in an abbreviation like “PEG-GO” or just say “With PEG based adjuvent”. We know PEG is in the ingredients list, so what is it being used to coat / protect?
OTOH: We know some amount of graphene is produced in nature as nanoparticles. Not much, but it exists (as do Buckyballs and such). So one big question I’d have about anyone finding it in odd places or things (like cotton swabs…) is how well did they assure it was not normal environmental trace amounts or contamination from somewhere else in their “lab”? When you find mystery goo everywhere you look, suspect your test is wrong or your zeal is excessive…
@Simon Derricut:
Part of why I’m not keen on adjuvents. They are not needed for a vaccine to cause immunity, they just reduce the amount of the “bug juice” needed to get a response AND dial it up (sometimes a lot). Then the vaccine makers, to get as much response as possible keep looking for ever more aggressive response (indicating to me ever more horrible materials…).
I already have a strong immune response to any foreign substance, AND strong tendency to allergies, AND a bit of RA starting up (eating various foods causes joints to feel bad, so also clearly environmental exposure issue) so the last thing I want is some “Horrible Immune Whacking Crap” poking that bear, and me not able to get it out of my blood.
@David A:
Interesting POV. Then we get Billionaires with a God Complex and / or Evil Urges and all hell gets created… ” to save us ” (or the planet)…
Speaking of finding a nut…
As evidence for the horrors of graphene oxide, one of those links has an image of a paper embedded… which shows that the normal immune system function breaks down GO. That makes me much less concerned about it. So the body has a generalized “alien biological / carbon junk” disposal system that also can handle graphene. Nice.
From this one: https://truthcomestolight.com/on-the-connection-between-graphene-oxide-found-in-covid-vaccines-electromagnetic-fields-blood-clots-severe-covid-symptoms-how-to-remove-graphene-oxide-from-the-body/
Actually, graphene is common in the environment.
Graphite is a well-known allotrope of carbon. Moreover, we consider it as a semimetal, and it has a layered structure with several layers of carbon that are well-packed on each other. One layer out of these layers is a graphene sheet. A graphene sheet is considered as a nanoparticle according to its dimensions.
https://www.differencebetween.com/difference-between-graphite-and-graphene/
Make your own graphene …
http://elementsmagazine.org/2019/06/10/graphite-to-graphene/
Thus my comment about contamination…
IF someone thinks graphene is exotic and synthetic only. so fails to allow for environmental contamination, they can drive themselves nutty with a very sensitive test…
FWIW, Graphite is used in all sorts of things including brake shoes, so I’d expect graphene fragments from it to abrade off into the environment. Then it also looks like coal & soot has some in it:
https://pubs.acs.org/doi/10.1021/ef020063y
Which may be part of why brake dust and soot are not good for you or your lungs…
So take graphite and abrade it, or take nano-sized soot particles, and my guess is you will find some graphene like areas in it. IF your testing doesn’t allow for brake dust and soot, you will likely find bits of it “everywhere” and in “everything”…
I just don’t see any reason to put it inside of ME.
Did you know that natural photochemical processing of terpenes makes graphene nanoparticles as well as larger ones known as soot? ;) I want to say this was published in the late 1980s or early 1990s.
CDQ – you mean as in the Smokey Mountains? That’s what makes the smokey.
Not sure what to make of this yet, but you heard it here first!!!
** CodeMonkeyZ BOMBSHELL ** Dominion Whistleblower Speaks Out – Releases Admin Password Proving Remote Access –VIDEO
https://www.thegatewaypundit.com/2021/08/codemonkeyz-bombshell-dominion-whistleblower-speaks-releases-admin-password-proving-remote-access-video/
@jim2,
That would be yes. It also makes for ground level ozone that some can smell ;p.
Well, where I am, this time of year; I get to breathe it whether I want to or not. It is a part of the natural photochemical haze we get when the plants are growing or blooming or fruiting and the sun is high and the UV is strong. That said, it is a smaller amount than you get breathing smoke directly.
another ian (3 August 2021 at 2:19 am) : “Eric Weinstein: There’s Been a Complete Absence of Leadership Amid COVID-19”
That was really good, so I am giving a link for it again, this time a direct link to the podcast:
https://podclips.com/c/NVmusD
Note that this link is to a segment in the middle and there are arrows to get to previous or later clips.
Eric says there has been a complete lack of leadership and that all the good options have been ruled out in this … whatever it is, pandemic or mass panic. That is obvious, but yet …
Don’t you get the feeling that someone is in complete control, we just do not know who.
All the “leaders” we see are just toeing the party line, but who is on top, making those decisions?
Maybe the top level is a cabal and it is all a back-room conspiracy, but in any case, all of that is hidden from us. Whoever or whatever it is, they do not have our best interests at heart.
@YMMV “Don’t you get the feeling that someone is in complete control, we just do not know who.”
Yes, it certainly seems that way. If this were all just a giant clusterf**k there would at least be the random action taken now and then that would make the situation better. Someone is on control. The steps to herd all the cattle into a narrowing chute toward a door marked “get your jab here” have been too concerted, too consistent.
@TMMV:
Absolutely! The actions are too coordinated, too consistent, too uniform. They span too many countries and mark time together. Some of that can simply be the “Monkey See Monkey Do” of some politicians (Cuomo) watching others (Macron) and aping them, but not all of it.
Plus the talking points are almost identical, even across different languages.
It is absolutely a controlled and planned process. The hard bits are the “who” and “to what ends?”.
It can not be a good ends or they would not be so secretive about the “management” of it. So my BS-O-Meter is near pegged on “Do Not Trust For A Moment Any Of Them Or It”.
“”Vaccine hesitancy” – that gets it said!”
https://bayourenaissanceman.blogspot.com/2021/08/vaccine-hesitancy-that-gets-it-said.html
@EMS – Re: Austin, Minorities and subjugation.
I have been saying for 30 years now that democrats, the party of the KKK and now Antifa, have not changed in the past 150+ years. They just changed tactics. They are the party of racism and slavery, All they did was give a few corrupt black politicians the illusion of power (paid them off) to get their sycophantic calling to the rest of the crowd. Actions speak louder than words. The left has not done a thing for blacks. Antifa has destroyed more black lives than the KKK could even dream of! THey couch their words differently, but their intentions are the same. Keep the minorities in their “place”. That is why they yell racial epithets at any minority that dares to escape their slave plantation.
E.M says @David A:
“Interesting POV. Then we get Billionaires with a God Complex and / or Evil Urges and all hell gets created… ” to save us ” (or the planet)…”
Yes, for certain, but it is the millions of, excuse the term, useful idiots, that make it possible. At my daughters high school graduation I listened to about six kids give their speech. They universally talked about creating a new world, saving the planet, global peace, etc… I found it very alarming. Zero of them felt any need to feed themselves, their loved ones, marry, have a family. They never worried about a meal or a shelter. They bought their lunches and 5 dollar mochas, they drive nice cars. I saw them as well intentioned self centered egocentric indoctrinated saviors, with zero inner introspection in to their own lives, their own flaws, their responsibility to care for themselves, and the responsibility of others for their own lives. Everybody in the world enduring any suffering was a victim, and they would save everybody. Self responsibility was a foreign concept. Their lack of understanding the ideals and responsibility of individual liberty and the foundational principles of the U.S. was complete.
I don’t know who is directing, yet it appears to be a consortium of globalist composed of well known politicians, hundreds of thousands of unelected bureaucrats, Big Tech, the media etc. The US deep state appears to have intimation power. This has been visible just following headlines.
Nevertheless I maintain that their success will be their demise for two primary reasons. As power consolidates who is really in charge is usually contested. And their philosophy of destruction to institute their own ideology. When one shatters a system, chaos tends to reign.
@David A: I long ago came to the conclusion that GEBs (note the plural) were working to “RULE THE WORLD!!!!” and have a limited number of serfs to attend to their every wont.
The GEBs are multi-billionaires, Deep State actors, Old, insanely wealthy family dynasties, and the odd evil genius here and there.
a) They are NOT that smart. The really really smart get sidetracked by the wonders of the universe. The bright-but-sociopathic lack the candlepower to really fully think things through.
ii) They are taking advantage of alliances and current synergies, much the same as the old feudal arranged marriages did, to accomplish a World-ruling globalist elite. But then the long knives come out when a few dozen of those GEBs are convinced that they are THE ONE who should rule.
It’s NEVER a fairytale ending.
–
–
–
So far, a few hardy souls with enough basic skills and knowledge have been able to jumpstart the remains of civilization after the many times this has been tried before. (But SO knowledge much is lost.)
–
–
I’m with you, David. Their success will be their demise. The smart, survivalists will win in the long-term.
One version goes “Those the Gods wish to destroy they first make confident”
“Well there you go” as the expression has it – or you don’t!
“Actions Speak Louder Than Words”
“Gibraltar is the only country in the world which is 100% vaccinated, and the CDC just moved them to their “Very High Travel Risk” category.”
https://realclimatescience.com/2021/08/actions-speak-louder-than-words/
RE GEBs. I’m wondering if people like Soros believe they have to take control of the world to “combat global warming” – noble cause corruption – or do they do it just because they can.
@jim2 – My understanding is that Soros is of a Marxist mindset and sees’ himself at the top.
Also, the way he has made his billions has been through shorting currencies. Destabilizing countries helps to crash the target country, and who better to do that than his useful idiot Marxist (paid) minions?
So I think he’s the top GEB, Both Greedy 1st and foremost, and Globalist. I guess he’s a GGEB.
But that’s just what I’ve read in articles and reports over the years. I have never dug down into everything-Soros because I know enough that he is toxic to any society or economy. He puts the ‘E’ in GEB.
.
.
BTW, I’m seeing GEB used on other sites with no explanation. The person using it seems to think others will understand the acronym, just like my use of BTW.
I think GEB originated here, but it would take a lot of Search-Fu wizardry to verify that. Anyhow, it’s been turned loose on the ‘net now.
The beginning of an awakening?
There’s a movement afoot in Virginia to recall three commonwealth attorneys who were elected in 2019 with a huge assist from George Soros’s money.
The “commonwealth attorney” in Virginia is akin to a district attorney in most other jurisdictions. Whatever you want to call them, their radical policies have contributed to a massive violent crime wave in counties in the Washington, D.C., vicinity.
https://pjmedia.com/news-and-politics/rick-moran/2021/08/03/virginia-group-looks-to-recall-radical-soros-backed-prosecutors-n1466633
On an unrelated subject (which I guess this thread is all about):
I am having a hard time getting all “het up” about serial molester Cuomo, when the real crime is his killing of about 15k elderly in Nursing homes which he got an Emmy and other awards for.
Seems a few women’s feelings are more important than thousands of lives.
Phil, I think it is their way of getting him out of the 15K murders with something a lot less serious.
Damage limitation, but he has refused go, against Biden’s wishes.
Because he would not be the only one being looked at for murdering the old and infirm.
Just FYI. Had a box built for I2P when you mentioned it waaa back. Was pretty unimpressed with first exposure, and was trending toward “cast aside and move on”. But your comment encouraged me to keep it running. And last night on Reddit there was some guy collecting thanks from everyone for donating bandwidth from his two datacenter grade I2P servers. Quick look at his posting revealed I move 6X what he does with my POS Atom board I’ve been so ashamed of. Comes to > 1TB/mo :)
So I guess all is good :)
Gets worse though. Am abandoning running a Tor relay after 20 yrs. There were some technical issues I was battling (Relay IP address being blocked by faceless corporation – why?)…but that didn’t generate the decision. The arrival of woke culture within the Tor organization did that. Just can’t see how cancel culture is compatible with free speech…..
Find myself becoming very hard and ruthless with individuals or companies subverting free speech. Collecting enemies is not something anyone should do. Cuz you just never know when those offended will find opportunity. Many in the cancel culture seem oblivious to the idea of Karma.
Karens of the world – watch out. Your squeal is coming. Eventually all of us are held accountable for our deeds.
@philjourdan
I don’t like this guy and find the landsharks to be very funny.
But you are so right about this one. Fweelings should pale compared to killing grandma. What is wrong with the news media here?
Ever notice how certain all these people are? Both the governor and his critics. These are the types on which you would use “preemptive action” if the price of hamburger went too high.
Cannibals all. They were HOA cretins in a previous life.
@H.R. (11:21 a.m.) – Can’t agree with you about Soros. He’s a Johnny-come-lately POS who is allowed to play as long as he stays in line – admittedly a “higher” (or should I say “lower”) line than all our bought-and-paid-for politicians, but he’s not even close to No.1.
I’d say Rothschild is a lot further up the chain – the Rothschild family has been screwing the whole of Europe for centuries, and by now probably “legally” own most of it. It is Rothschild and his cronies who sit round a table once a week and set the world price of gold, and why not, when it’s their toy. No, Soros is a nobody in comparison. And I don’t think for a moment that Rothschild is No.1, either, though it gets mighty dark at those levels, so very difficult to see who’s there.
@Taz:
You got a pointer to the WOKEing of Tor? I did a quick search but mostly just turned up very old news. What are they doing that’s “Woke”? (Don’t they just make a browser and router code?…)
Isn’t anyone able to take the code and keep a “clean” version non-woke going?
But that reminds me that I’ve let my I2P board go idle for too long… need to get back to that.
Alberta the wrong side of the law on masks etc
https://www.bitchute.com/video/0xxajGqSjes9/
“More for the Maskarade”
Click to access Masks-Dont-Work.pdf
@Another Ian:
That’s quite the show… So one guy, self represented in court, is driving things to the wall… Gotta luv it… ;-)
Lambda variant coming to the news near you soon.
@E.M.
And hopefully more contagious than the Lambda variant
E.M.
Ummm! Might be “Alberta – down to earth”
http://www.smalldeadanimals.com/2021/08/05/august-5-2021-reader-tips/#comment-1478746
“An Honest Explanation About Joe Biden Inflation, and It Has Nothing to do With COVID
August 4, 2021 | Sundance | 43 Comments”
https://theconservativetreehouse.com/blog/2021/08/04/an-honest-explanation-about-joe-biden-inflation-and-it-has-nothing-to-do-with-covid
“As go South Africa and Zimbabwe, so goes the world???”
Serious reading (IMO)
https://bayourenaissanceman.blogspot.com/2021/08/as-go-south-africa-and-zimbabwe-so-goes.html
Another look at inflation
“Inflation and the “stealth” default on US government debt”
https://bayourenaissanceman.blogspot.com/2021/08/inflation-and-stealth-default-on-us.html
“Making money out of stupid COVID-19 regulations
I had to laugh at a range of face masks, proudly brand-named FAKE MASKS, sold by an online vendor. I think they’re just what we need to freak out every Karen in the vicinity – and they’re no more or less effective at preventing the transmission of COVID-19 than the real thing.”
https://bayourenaissanceman.blogspot.com/2021/08/making-money-out-of-stupid-covid-19.html
On the news this morning, the Moderna mRNA vaccine is 93% effective after 6 months after the second shot and they intend to apply for “normal” use authorization. The booster is supposed to be for those who are immuno-compromised or have certain other serious issues, not for everyone. So says the news. We’ll see what actually happens.
Oh Dear:
https://www.eutimes.net/2021/04/breaking-irish-government-admits-covid-19-is-a-fake-hoax-scam-which-does-not-even-exist/
EMS @ https://chiefio.wordpress.com/2021/07/23/w-o-o-d-23-july-2021/#comment-148470
OK.
@Another Ian:
On the flight back from Florida, knowing I would be Mandated A Mask for about 12 hours continuously (airports and flight), I deliberately wore a “Surgical Mask” that is very thin paper and with the nose wire bent such that it leaked a LOT and made it very easy to breath.
I tend to keep one of those with me at all times outside the house… just in case of a Karen Or Chad Attack ;-)
BTW, i think that EUtimes article ought to be titled “Irish Government has no clue about Covid” as opposed to saying it does not exist…
I saw a comment somewhere some weeks ago saying that a medical researcher had asked the WHO itself where he could get a sample to work on, and that they’d said they (of all people) couldn’t help. I didn’t bookmark it because it was third or fourth hand at best and could too easily have been fake, but if this is right maybe it wasn’t. It would certainly fit with other stuff I’ve read which said that all the PCR test amplifies is generic breakdown products of a wide range of respiratory viri.
All we need now is confirmation of the piece I saw which said that one of the gene strings the test was designed to test for was part of human chromosome 8 – the article had pictures of an alleged spec. form with the said string highlighted, but then, these days, with Photoshop, it would, wouldn’t it? (with apologies to Mandy Rice Davies ;-)
I’m sorely tempted now to put this one down as another confirming instance of my working theory that the mainstream conspiracy “narrative” is generally far closer to the truth than the MSM “narrative”! (and if you think I’m mocking the word “narrative” with those quotes, you’re dead right.)
“Infrastructure” Bill to include mandatory alcohol testers in all new cars:
https://www.theepochtimes.com/infrastructure-bill-would-mandate-alcohol-monitors-for-all-new-cars_3933135.html
Hmm, didn’t they have those back in the late 70s or early 80s? Yeah, I am old and while I do want to think that I’m remembering correctly, I am aware that a negative internet search doesn’t mean much. I wonder if there are any Car and Driver or Road and Track magazines from that era that have searchable archives.
Well, this: https://theconservativetreehouse.com/blog/2021/08/05/richard-trumka-dead/ is interesting. I wonder how the power struggle will end ;p.
@CDQuarles:
Gee… another “heart attack”… One wonders if the Former Coal Miner was getting uppity about all the union coal mining jobs being lost…
Interesting stuff here:
https://rumble.com/vbc84z-earth-shaking-election-fraud-news.html
VERY limited folks run the “certification of voting equipment” company, and they are Dominion folks. Cat guarding pigeons?….
looks like a big “BUT”
“A Pandemic of The Vaccinated – Does The Vaccine Create a Pathway For A More Dangerous Variant?
August 5, 2021 | Sundance | 180 Comments”
https://theconservativetreehouse.com/blog/2021/08/05/a-pandemic-of-the-vaccinated-does-the-vaccine-create-a-pathway-for-a-more-dangerous-variant/
“Category: Government funding of science”
Willis has a look
https://wattsupwiththat.com/category/government-funding-of-science/
“Taxpayer dollars are the lifeblood of the climate alarmism scam. If those dried up, so would all of the hysteria and shouting.
Why would the hysteria stop? Because the real truth is, there is no climate emergency, and people are waking up and noticing that fact. Don’t be the last to get the memo …”
Just a little reminder for anyone who may have forgotten the fact that “the PCR tests don’t work”. The conflation of “cases” with “positive PCR result” is the root of much evil. Even knowing that, we still (well, I do anyway) tend to get drawn into discussions as if the word “cases” actually has some meaning.
@ Steve C re: “All we need now is confirmation of the piece I saw which said that one of the gene strings the test was designed to test for was part of human chromosome 8…”
I remember seeing that somewhere. It might have been on Twitter. That was long enough ago that I may not have preserved it.
Nowadays I try to save at least a screen shot of most things that catch my eye. But if they give a link to a journal article, I generally download that and save it at least two places, and I might even print a hard copy.
AI, I asked my son, who wanted to get tested because his friend tested positive, to ask for the cycle count to be disclosed as part of his test results. The test givers had no clue what that was. I don’t expect them to know, but you think they would if they are doing the swabbing and testing?
What, nobody else asked out of the thousands they processed? Just sayin>>>
Something to puzzle over here (IMO)
“Thought I’d put this here as interest for those looking at vaccines, my daughter living here studying nursing had a Serology test for immunity against the main diseases for when she does placement and found she has none except for one despite a record of vaccinations since birth.”
https://joannenova.com.au/2021/08/people-deficient-in-vitamin-d-are-14-times-more-likely-to-get-severe-covid/#comment-2451150
@Another Ian:
I doubt they tested memory T cells. They have the job of remembering how to make antibodies for a given disease “on demand”. The body doesn’t keep churning out antibodies all the time, it is a waste of energy and resources… But it does remember the formula “for that day”…
“Ontario Vaccine Injuries”
http://www.smalldeadanimals.com/2021/08/05/ontario-vaccine-injuries/
@E.M.Smith
6 August 2021 at 3:02 am
Reply relayed and poser of question says thanks
From comments at SDA
“rd
August 6, 2021 at 1:49 am
Biden wants HALF the US cars sold to be electric by 2030.
Minnesota Governor Walz wants more before 2030.
I think a Road Service Electric Charging Station will be a profitable growth industry.
Reply
Frances
August 6, 2021 at 1:55 am
You’re going to have to plant one heck of a lot of currant bushes.”
@Ossqss re asking about number of cycles.
I had to get tested for FauXi’s Flu last September before I could get shoulder surgery.
I asked the swabbers how many cycles they were running. All I got were blank looks, but I’d bet that they knew.
The number of cycles being run seems to be a State Secret.
I also had read a year ago that (Rumor Alert!) they were running fewer cycles for people that were being admitted for surgery. Something like 20-ish cycles and if you tested positive, you were definitely an active case.
I was very nervous because my shoulder was killing me and I really, really needed the surgery. I was afraid a false positive would prevent me from getting in for surgery.
I tested negative, yet I’m pretty sure I had been exposed to the bug. I went out in public a lot and always wore my mask that I had attacked with a hole punch. If they ran a high cycle count on my sample, I’m pretty sure they would have gotten a positive.
So I think the hospital wanted the revenue and did not want to reject anyone unless they truly were an active case. I think the different #cycles for different reasons rumor is likely true.
–
That’s all I have to add to ‘cycle counts and playing dumb.’
For Power Grab. There are articles like this all over the internet. Search: “covid pcr test” “chromosome 8”
I haven’t investigated it, but I am skeptical about it.
Bombshell Evidence: COVID RNA Base Pairs are Identical to Chromosome 8 Human DNA
https://ourgreaterdestiny.org/2020/08/bombshell-evidence-covid-rna-base-pairs-are-identical-to-chromosome-8-human-dna/
So being a whole chromosome, #8 had a lot of base pairs. There might be a duplication to one of the covid strings somewhere on it, but that doesn’t matter. Not exactly the “bombshell” I was expecting.
The finished sequence of chromosome 8 contains 145,556,489 bases
https://www.nature.com/articles/nature04406
@jim2 – Thanks for what looks like a fair bit of ‘due diligence’ on that one. When you say ‘that doesn’t matter’, is that because the PCR test would need to have the given sequence unattached to the rest of chromosome 8 to reduplicate it (presumably fairly unlikely, given the relative sizes of sample and chromosome)? I must confes I’m rather in the dark about the inner details of the multiplication process and how it ‘decides’ what to amplify.
The question does remain (IMO) as to why a piece (even a tiny piece) of ‘our’ DNA should be among the samples at all – if you can find it, so could the WHO experts specifying targets for PCR.
@Power Grab: “Nowadays I try to save at least a screen shot of most things that catch my eye. But if they give a link to a journal article, I generally download that and save it ”
I am doing something similar. I want a record after the dust settles. As for the report that the PCR is showing positive for a fragment that exists in normal human gene, I had a link to that on YT, but it has been scrubbed. Praise the all knowing wisdom of YT!!
@jim2: “So being a whole chromosome, #8 had a lot of base pairs. There might be a duplication to one of the covid strings somewhere on it, but that doesn’t matter. Not exactly the “bombshell” I was expecting. The finished sequence of chromosome 8 contains 145,556,489 bases”
Perhaps I am confused. Why is that NOT a bombshell? There are always bits and pieces of destroyed cells present in human fluids and if that segment is present in our DNA then it is a near mathematical certainty that SOME of that sequence is floating out there. How much? Who knows? But all it takes is one or two molecules on the swab, and if you run the PCR at 40 cycles you are likely to get a positive. What am I missing? Why is that not a bombshell?
TTN – there are only 4 bases in human DNA. So the chances of a small segment matching some DNA somewhere in the whole genome is quite high.
@jim2: The segment of human DNA in question (From your link at https://ourgreaterdestiny.org/2020/08/bombshell-evidence-covid-rna-base-pairs-are-identical-to-chromosome-8-human-dna/) is 18 base units long. 4^18 is just under 69 billion. Chromosome 8 is under 146 million. The chance of a random 18 base segment being part of Chromosome 8 is just under 1 in 500, so the chance that it is part of ANY chromosome (even assuming random segments and that EVERY chromosome is random instead of using similar chemical structures, which is not really reasonable) might be roughly 1 in 10 — and yet that known-to-exist same 18 base segment is what is being tested for. So, again, am I confused? What am I missing? It looks to me like the chance of finding a random 18 base segment somewhere in the human genome is still less than 1 out of 10, even assuming the best case scenario where bases are strung together in a random chain in all chromosomes. But that is not really the point. All that that does is tell us that the test MAY HAVE, with one chance in 10 (or less), been accidently designed to detect a sequence with the same 18 base string which humans have naturally. The important point, in my opinion, is that having found that the PCR test DOES IN FACT check for a naturally occurring string, why oh why was it allowed to continue in use?
The fact that the segment being tested for is a part of even a single human chromosome still looks like a bomb shell to me. Sincerely, please correct me if I am missing some factor.
@Another Ian:
As California was leading the way on Tesla sales early… I’ve already seen a BIG Pickup Truck with, in the bed, a modestly large Diesel Generator and “charging appliance” with those funny paddles and plugs. It was running down the freeway and passed me. I presume to rescue someone stranded out of juice.
I’ve also seen a EwTube where someone was delivering a person with a can of gas to a Tesla and constantly saying “But what are you going to do with the gas?…” (I suspect it was staged, but whatever) They get to the “out of juice Tesla” and then says “That’s where you plug it in, you can’t put gas in there!” and the car owner opens the trunk to show a Honda Generator sitting there…
Yeah, it will be a growth market until there’s a charging station every 10 miles…
@Per analog sections of DNA:
Note that “context matters”. The same segment in the middle of “some other stuff” will do something different. There’s a LOT of control structures (much of which used to be called “junk” DNA that control what gets opened for use, and not. The whole chunk of DNA acts rather like a hologram. “One Gene One Protein” is entirely wrong, even though it was the mantra for years.
Now, some difficult math also comes into play as does a quirk of biological history…
First off, you MUST think in terms of statistics. Things are not “yes” and “no” they are stochastic. Yet at the same time, they are NOT RANDOM. It is structured and orderly, with the occasional pot stir and randomizing small event. This makes the math of it all truly horrible as there are “how random?” and “how orderly?” variations all over the whole GIGANTIC genome.
Now, just to stir the pot a little bit more: About 8%-17% (estimates vary) of our genome, we got FROM VIRUSES including the gene for the protein in the placenta that lets it bond to the uterus without an immune attack.
http://isciencemag.co.uk/features/the-syncytin-gene-viruses-responsible-for-human-life/
Then there’s all those genes we share with other species. About 98% with the chimpanzee, not quite as much but still up there in the 90’s IIRC with the Pig (but the location on chromosomes are all different as are the control codes)
https://ansc.illinois.edu/news/human-pig-genome-comparison-complete-0
Nature is both highly conservative and constantly stirring the pot.
So I’m not at all surprised to find out we have almost the same genes as a pig, or that some protein in a virus is also found in people.
I’ve said it often, and will again: Biochemistry is terribly messy with bits of random and only modestly predictable. Every person is genetically unique and at the same time highly the same in most of it.
Now add to that the way nature will “re-purpose” some bits. It has this protein laying around, and finds that in the context of some OTHER protein or feed-stock it can do a different job too. So you find bits of DNA coding for a thing that’s the same as in some other animal, but doing a different job in people. Take that synectin:
https://pubmed.ncbi.nlm.nih.gov/19509165/
The upshot of all this is pretty simple:
1) ALL LIFE shares a boat load of genetic history and often the same genes. Once nature invents a good protein it tends to hang onto it and “share it around”. Bacteria exchange such information on little rings called “Plasmids”. Viruses do it directly. Both do it across species. Some critters, like planaria worms, just eat it and absorb it. (Truly ghastly experiment was done. Train a Planaria with electric shocks to run a maze. Dice it up and feed another planaria. It learns the maze much faster…)
2) Biology of life is A MESS. It’s a quasi random stirred pot with whatever kludge worked being passed on and sometimes essential bits being thrown out just to see if they are really needed (why for most animals Vit-C is a hormone, but for us and guinea pigs it is a needed vitamin.) It often does not use “the best path” (just whatever worked) and often uses bits of biochemistry in strange and wondrous ways not present in the original species that created it. Some gut bacteria turn on or off different genes IN YOU to get what they want…
So you simply can not come at biochemistry expecting to find something rational, orderly, predictable, or even sane. As one wag put it: “God has a hell of a sense of humor, running a waste disposal line through a recreational area…”
Then, given the incredibly large size of the human genome, with some bits turned off at various times, or all times, and only 4 letters used in groups of 3 to code for everything: I would be astounded to find that there was NOT a lot of it matching various small segments from viruses, bacteria, even pigs and mushrooms… (Mushrooms make Vit-D in the sun, as do we…)
IIRC, it was only after the PCR test was running that someone looked at the human genome and found a matching bit in one chromosome. That segment, to the best of my knowing, has not been stated as to active, passive (off), “junk” etc. It is also unclear if given the gene location it would normally be broken up upon cell death in the middle of that sequence, or liberated at the ends… (i.e. where are the introns et. al. and stop codes and…)
That the PCR test is not tossing a positive for everyone says something in the process (mostly?) prevents this. Given the number of false positives is large, whatever it is might not be enough…
This, if true, is horrid: https://theconservativetreehouse.com/blog/2021/08/06/this-is-nuts-moderna-and-pfizer-intentionally-lost-the-clinical-trial-control-group-testing-vaccine-efficacy-and-safety/. The original report came from NPR, so is a bit questionable; but … how can there not be “vaccine hesitancy” given this, again, if true. Add to that this is going to make both groups horridly self-selecting and thus poorly generalizable. :(
“Fully vaccinated can be just as infectious as unvaxed (What’s the point of a Vax Passport?)”
https://joannenova.com.au/2021/08/fully-vaccinated-can-be-just-as-infectious-as-unvaxed-whats-the-point-of-a-vax-passport/
@EM: Yes, the general idea that most people have is that DNA “is the blueprint used to construct and control the biological systems and processes in a living organism”. Nope. Not even close. The only reason why that idea is so popular is that it is simple to learn and simple to teach. Biology is a HUGELY chaotic process, and DNA is more like the initial system state of that chaotic process. It is NOT a plan, it is an initial input and the chaotic system moves toward a strange attractor which is, in fact, the phenotype of the individual involved. Do exactly the same process a second time, and because the chaotic system (which is composed of ten to the umpty ump atoms and molecules in a constant dance) is never the same twice, you will end up at a different attractor, usually one close, but not the same. Thus, even with “identical” twins, gestated at the same time and in the same womb, they will be similar, but NOT really identical. (My two grandkids are identical — and yet the hair of one swirls clockwise on the back of his head and the other swirls counterclockwise.)
It does not really matter whether the 18 strand segment is normally active or passive. We are not necessarily looking at whole strands. All the test wants to know is “is that strand here?” The PCR test will operate on small debris just as well as long strands. Unless we have some very good reason for thinking that the PCR segment tested (which we know exists on Chromosome 8) is somehow protected from being produced when DNA is disassembled, it seems reasonable to expect false positives from the test. My understanding is that the first stage of the PCR test disassembles longer strands, and it may be possible that it uses an enzyme to cleave things which does not normally cut at the beginning of that 18 base unit strand — but is that true for DNA which is taken apart by ordinary biological processes to form debris? Still looks like a bombshell to me.
@TTN:
I don’t know enough about the procedures of the test to call it a “bombshell”. Are cells removed via filtration? Are cellular debris removed? Is there some process that only lets virus particles through? Are degradation products of cellular death processed in such a way that fragments of 18 long do not survive?
I just do not know.
So I can’t call it a “bombshell”.
But is sure is crazy….
Ha!, so basically, if we ignore the accurate specifics, disregard the data, forget about history and medical science, analytics, then anyone should feel confident/comfortable with what you see conveyed globally, daily?
Think about it >
I would say, the Laura Ingram link on the “one protein” (not really a Vaxx), speaks volumes on the perpetuity of the situation.
“Morano and Bastardi Host Zoom Event”
Details here
“Softly, softly catchee monkey” maybe?
“Margin Of Fraud”
Georgia
http://www.smalldeadanimals.com/2021/08/07/margin-of-fraud-81/
I saw this piece pop up in my Google feed (Android phone) and, considering the source site, anticipated it being a hit piece on either Trump supporters and/or vax skeptics, but was pleasantly surprised with an intelligent and slightly enlightening piece. It’s certainly worth the 5 minute read.
https://news.yahoo.com/infantilization-western-culture-151012591.html
I’m curious about the inner workings of the PCR test, but don’t have time to fully explore. What I know so far it that it takes two primers to make it work. Notice there are two primers for two sequences of interest (of the COVID virus). Both have to find their target for that segment to be replicated, so the fact that ONE primer matches some other part of the human genome isn’t enough to throw off the test. There are a lot of good videos explaining how primers and other parts of the test work.
I’m just tired of these breathless “bombshells” on the internet. I don’t know what the motivation is for sowing unnecessary fear about the virus or the vaccine or the test. There is enough to be concerned about. We don’t need people who lie or are simply being an incompetent boob trying to get eyeballs for money.
I think I’ll jump in again, may be useful – or not! See earlier my earlier comment for sources and some links. Part of my 7/28 comment up thread regarding the operation of the rtPCR process:
….
Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:
RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
E gene (Orf1ab) – small membrane protein used in viral assembly
N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation
The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)
The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.
…..
In my line of work the PCR portion of the process is what is known as a “rubber ruler” as a Tech can run as many manufacturing cycles as needed to make the probe dye visible, regardless of the original quantity of tagged material present when starting the PCR manufacturing process. This is part of the concern over the testing houses refusing to release with a test result the number of manufacturing cycles that were run before declaring a negative or positive result.
As for the non-specificity of the sequences used in the forward/reverse primers, this can be assessed using the BLAST database at NIH and reviewing the search results. Note that per the WHO website, different countries are using different sequences for their initiators (forward/reverse primers)
Thanks for that, DoNoNorth. So can you answer another concern that has been raised here? How often does the PCR test show a positive result when there are ZERO viral RNA? (Note, for RNA viruses, the RNA has to be transcribed to DNA first.)
Doximity purports to have about 1.8 million members. The site isn’t anonymous, so users can see the names and credentials of everyone they interact with. It’s typically used to communicate with patients, monitor industry trends and share research. Now, according to Malarik, it’s a breeding ground for COVID-19 misinformation.
Commenters on the site will frequently argue that natural antibodies from COVID-19 are more protective than mRNA vaccines, claim the vaccine is unproven and experimental and overemphasize certain side effects, according to CNBC.
Sometimes, more harmful ideas emerge. One doctor on the site reportedly claimed that the COVID-19 vaccine has already killed 4,000 people, which is untrue, and said that mandating it was equivalent to murder. (RELATED: Even With Breakthrough Cases, The Data Doesn’t Seem To Support Mask Mandates For Vaccinated People)
https://dailycaller.com/2021/08/06/doximity-covid-coronavirus-misinformation-vaccine/
More audits!
https://www.thegatewaypundit.com/2021/08/wisconsin-rep-janel-brandtjen-issues-subpoenas-audit-2-counties/
@Jim2, IIRC Faucci says we start approaching 100% unreliability once the amplification cycles in a PCR test reach 35. To think, the now removed, CDC mandate of 40 was in place through last year is mind boggling. Comparatively, the CDC now mandates up to 28 cycles for testing symptomatic jabbed folks as was documented on their website and posted here prior.
DoNoNorth may have more or different info, but I believe one standard for other PCR applications is 40 cycles – although that may have to be adjusted to fit the case.
The problem with COVID is the RNA persists in the body for well over a month. By this time the patient is usually asymptomatic, but the PCR test can still detect the RNA. I believe that is why the number of cycles was adjusted down and also the reason for St. Fauci’s statement.
Oh, the link to persistence paper:
Link:https://wwwnc.cdc.gov/eid/article/26/8/pdfs/20-1097-combined.pdf
@Jim2:
Part of the problem is that there is never ZERO in common lab work. You would need to be doing all this in a BSL-3 or BSL-4 room with bunny suits and even then I’m not sure you could get to ZERO. You would need to wash out the nose and then wait for new particles to form too, as otherwise you are just testing the air the person was breathing before they entered the BSL-4 lab.
People are shedding all sorts of crap all the time. The testers, the patients, the folks who road in the car last week, etc. In my 3.5 months living in a box for NASA, we discovered various things they would need to deal with in a space station. The one that was a bit of a surprise for me was the quantity of hair and skin particles / dust that accumulated. We were in a closed filtered air room with no windows. At the end, you could see it coating anywhere that had not been cleaned well (like behind the beds, between table and wall, etc.)
A fine white layer of epithelial cells… with hairs in it. So NOTE to NASA: Include hand vacuum in supplies sent up…
So that swab up your nose gets waved about in the air. Then your nose has been busy filters hundreds of liters of air and sticking all the stuff it finds into the goo in your nose. That’s what gets tested. At the lab, it gets waved about a bit more and you hope the lab tech isn’t shedding anything and is very careful. Is that air at BSL-4 level of filtration? Were the supplies used to clean the room and the equipment cleaned to BSL-4 and stored in a BSL-4 space? The answer is “No”, so you can rest assured there ARE other particles of “stuff” in the air, the room, your nose, and on the swab.
Normally you expect that contamination to be low enough that it does not get amplified into a positive test result. BUT that depends on number of cycles and the ratio of target to contamination. If you have NO target, but a little contamination, and run enough cycles, it will turn positive. That’s the False Positive rate that goes high over about 30 and is nuts at 40+.
There’s a stochastic element to this also. The “gluing together” of amino acids into a DNA strand is not perfect. The error rate of it is also low enough that with a big enough starting target to amplify, the target gets to “enough” before random bonding makes a target strand to amplify. But run a hot/cold/hot/cold cycle long enough, you will get some random strands forming (that is likely how life was first evolved, BTW, the random bonding started making interesting bits in the mud puddle). Again, if your cycles are kept low enough, under about 30 to 40, this is not a problem. Run it a few million you can create the first bacteria… In between? Random bits.
That’s what people mean when they say that if you run it long enough you WILL get a positive. Just mostly it isn’t ever run that long / that many cycles.
In fact, the cycle count at which you get a positive is a key diagnostic. Flip a positive at about 20 or less, you are highly infected. Positive at about 32-35 is likely just that you are already over it and that’s left over fragments in your blood, or debris of dead virus that was floating in the air you breathed. Over 40? Could be just about anything and you are basically not infected (small possible that a few viruses are in the nose trying to make you infected and it’s your first few hours…)
Without knowing the cycle count used, you can not say with any certainty that you are sick, got over it but still have fragments, not sick at all, or never been near the virus. ALL can give a positive result at some number of cycles.
The test is a horse race between amplification of a target sample, and random DNA formation from hot / cold cycling and contamination bits. The random is usually slow enough to not make anything of interest inside any sane number of cycles you run, but if people are NOT infected, and you run the test long enough, you will get stuff forming. Then it is just a matter of time and cycles…
Another problem, without knowing the true prevalence, is whether the PCR picked up, indirectly, the RNA of the SARS-CoV2 virus or one or more of the hundreds of other corona viruses out there. Nucleic acid strings are not unique, particularly so for short ones.
Simply put, the PCR test was not designed to be a medical diagnostic test. A potential screening test, maybe; but diagnostic. no, in my opinion.
cd: “[…] but diagnostic. no, in my opinion.”
Well, since the inventor of the PCR test shares that opinion, it’s not just “in your opinion.”
😜
@H.R.: “Well, since the inventor of the PCR test shares that opinion, it’s not just “in your opinion.””
Here is Nobel Prize winner, Kary Mullis, the inventor of PCR: “You can find almost anything in anybody”
https://www.bitchute.com/video/2llufzHVUBAX/
I haven’t been able to find any credible accounts the Mullis said the PCR test isn’t good for a diagnostic test. But I did find the article about him – and it’s fascinating!
Over the next several months, while Mullis continued to produce ambiguous results, the second group led by Henry Erlich and Norman Arnheim hit the jackpot. Mullis had been right all along. PCR worked.
The technique was a scientific turning point. Within just a few years, use of PCR exploded, fueling the expansion of the biotech industry. Berkeley professor of molecular and cell biology David Bilder, says, “PCR revolutionized everything. It really superpowered molecular biology—which then transformed other fields, even distant ones like ecology and evolution. … It’s impossible to overstate PCR’s impact. The ability to generate as much DNA of a specific sequence as you want, starting from a few simple chemicals and some temperature changes—it’s just magical.”
In 1986, Mullis quit his job at Cetus. Before he left, management awarded him a $10,000 bonus for his idea, but the rights to PCR belonged to the company. Years later, Cetus would sell those rights for $300 million. Mullis held an eternal grudge. He felt he’d been ripped off, that White, Erlich, Randall Saiki, and others sought credit for what should be solely his. He called them vultures.
https://alumni.berkeley.edu/california-magazine/winter-2019/intolerable-genius-berkeleys-most-controversial-nobel-laureate
Here is a video of Mullis discussing the PCR test …
@jim2 – My understanding was Mullis said it wasn’t suitable for diagnosis. I think he is OK with it for screening. But to diagnose that you absolutely, positively, 100% have FauXi’s Flu requires a different test.
I haven’t watched the video yet. Just got here and I’m catching up on comments and then I have more running to do.
Anyhow, I hope there’s more on that quote in the video. I’m pretty sure the first I heard of it was over a year ago. Do consider that a quote like that may have been disappeared from the interwebbies. And… he may not have said that. The answer should turn up soon.
He explained that he meant you can find one molecule of something in somebody. From what I’ve read and watch so far, I don’t get the idea he thought PCR could NOT be used as a diagnostic test. I haven’t found anywhere he said that explicitly. This may be another case of a leap rather than a bridge.
And as EMS has pointed out before, no test is perfect.
While cleaning out some old links, I ran across a pretty thorough and well cited article from earlier this year.
https://www.oralhealthgroup.com/features/the-problems-with-the-covid-19-test-a-necessary-understanding/
Interesting paper, ossqss.
@jim2 I think I would find your thoughts more understandable if you told me what exactly you mean by “a diagnostic test”. In the video you linked (and it is part of the video I linked as well) Mullis says at 3:18 that “it doesn’t tell you that you’re sick and it doesn’t tell you that the thing you ended up with was really going to hurt you or anything like that”.
Aren’t those things exactly what we mean when we say that a test is diagnostic?
“Pathologist Dr Ryan Cole Delivers Concerning Message About COVID Vaccine and Long Term Impacts
August 7, 2021 | Sundance | 567 Comments
Before getting to the sketchy part; first,”
https://theconservativetreehouse.com/blog/2021/08/07/pathologist-dr-ryan-cole-delivers-concerning-message-about-covid-vaccine-and-long-term-impacts/
Read it all
TTN – I infer from the wording of your question that you believe there to be one, perhaps only one, definition of a diagnostic test, presumably in the field of medicine. According to this definition, the COVID PCR test would qualify as a diagnostic test. So in this case, it would be a confirmatory diagnostic test.
The purpose of a diagnostic test is to establish the presence (or absence) of disease as a basis for treatment decisions in symptomatic or screen positive individuals (confirmatory test).
https://www.healthknowledge.org.uk/public-health-textbook/disease-causation-diagnostic/2c-diagnosis-screening/screening-diagnostic-case-finding
@jim2: “The purpose of a diagnostic test is to establish the presence (or absence) of disease as a basis for treatment decisions in symptomatic or screen positive individuals (confirmatory test).”
OK, I think we can agree that the PCR test is NOT being used “to establish the presence (or absence) of disease as a basis for treatment decisions in symptomatic” individuals when the test is used on asymptomatic individuals. So, is the PCR test used to “screen positive individuals(confirmatory test)”?
Here is what I find for “confirmatory test”:
confirmatory test
(kŏn-fĭr′mă-tor″ē)
A examination used to validate the results obtained by another. The confirmatory examination may be more sensitive or specific but must be based on different examining principles.
Medical Dictionary, © 2009 Farlex and Partners
https://medical-dictionary.thefreedictionary.com/confirmatory+test
I do not understand how the PCR test is being used as a confirmatory test. In what way is it being used “to validate the results obtained by another” test based on different principles?
EMS – I’ve been considering the mutation aspect of the PCR test. Only the segment of interest gets replicated, so if any mutations occur, it would be on that segment. The mutated segment might not bind with the primers, and its replication would cease. Or, the mutated segment might not interact with the “probe”, and therefore not be detected. The Devil is in the Details.
TTN – I think an example would be if a patient presents with respiratory distress. The doctor observes that symptom. So, two likely candidates are the flu and/or COVID. The PCR test could then be applied as both a confirmatory test (it’s the flu and or COVID) as well as a diagnostic test of the first kind, the presence of disease.
Or perhaps both flu and COVID PCR tests are negative. My doctor in that case would probably just prescribe an antibiotic and call it a day.
@jim2: OK, I think we are making progress (or at least I feel like I am getting a better understanding of your position). If a person has already shown symptoms which are indicative of COVID, then a physician could properly consider the PCR test to be diagnostic. But if a subject is asymptomatic, then the PCR test is not considered to be diagnostic.
OK, sure — I am fine with that, no problem. Under specific circumstances, PCR tests can be diagnostic, ASSUMING of course we know that they are being conducted properly and are reproducible.
But that still does not change the fact that millions of “cases” were reported based solely on a PCR tests on people who never required medical care or even had no symptoms at all, in defiance of all previous uses of the definition of “cases”. And we STILL don’t definitively know (crazy, huh?) what the false positive rate of the test is. And we also know that labs were inexplicably being told to run the test at a known-to-be-extraordinarily-too-high number of cycles. And we still have the problem of Mullis saying, “it doesn’t tell you that you’re sick and it doesn’t tell you that the thing you ended up with was really going to hurt you or anything like that”. Any one of those reasons SHOULD have been enough for authorities to declare that the numbers coming out of mass PCR testing had no reliability, and no descriptive or predictive power to show what was happening on a large scale.
No matter how I look at this, mass PCR testing (even for that subset of people who were symptomatic) under these conditions looks to be a gigantic clusterf**k. Even worse, it seems impossible that it is an accidental clusterf**k.
My apologies for taking so much of your time, jim2. I appreciate your help and input.
@Jim2, this was the part I found pertinent to your quest.
“Mullis was quite adamant that PCR-viral load tests do not detect free infectious viruses, but rather identify genetic sequences of viruses.18 Recently Bullard emphasized that conclusion by stating, “RT-PCR detects RNA, not infectious virus…”15 It is not the whole virus that is being amplified but bits of its genetic sequence which, without the protein coat, are not infectious. Therefore, it is a mistake to infer that the test identifies whole infectious virus. In addition, the test assumes that the small gene segments are unique to SARS-CoV-2. However, since no acceptable viral isolates are available to confirm this relationship, the assumption is highly questionable. As noted above, the RNA sequences that are being amplified by surrogate DNA could be from sources other than SARS-CoV-2.”
Medical advice
“Talk to your doctor”
https://michaelsmithnews.typepad.com/.a/6a0177444b0c2e970d026bdee68a44200c-800wi
Ossqss. Yes it doesn’t detect the whole virus, but AFAIK, there isn’t another virus the test detects (parts of). I guess that is still a possibility.
On isolates:
The etiologic agent of the outbreak of pneumonia in Wuhan China was identified as severe acute respiratory syndrome associated coronavirus 2 (SARS-CoV-2) in January, 2020. The first US patient was diagnosed by the State of Washington and the US Centers for Disease Control and Prevention on January 20, 2020. We isolated virus from nasopharyngeal and oropharyngeal specimens, and characterized the viral sequence, replication properties, and cell culture tropism. We found that the virus replicates to high titer in Vero-CCL81 cells and Vero E6 cells in the absence of trypsin. We also deposited the virus into two virus repositories, making it broadly available to the public health and research communities. We hope that open access to this important reagent will expedite development of medical countermeasures.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7239045/
I’m sure there’s been progress on isolates, but don’t have time to do a deep dive.
TTN – I don’t know if the PCR test has been used a lot on asymptomatic people. I guess someone might do that as part of a study. But for a diagnostic test, it is usually used in conjunction with the fast antibody test and of course an exam by a physician.
All I’m saying is I think it is a useful tool in the diagnosis of COVID. It is only one tool in the bag.
As you and others have said, we don’t have a clue what the real number of cases is. But between that group and the vaccinated, we should be approaching a large percentage of people with some resistance to the disease, if not outright immunity. I haven’t read about many who had the infection getting it a second time. I certainly don’t want more masks and lock downs. Personally, I think we are over the hump. Let more people get the Delta or other new variants if they are susceptible.
Hopefully, they will keep some ivermectin in their back pocket.
At the end of the day, I’m just trying to get at as much truth as there is to be had in a complex environment.
@Ossqss – Ah… that’s ringing a bell with me.
I’m ‘pretty sure’ jim2 is correct that Mullis never directly said the PCR test wasn’t fit for testing for Covid.
That’s why nothing is there to find. You have to take what Mullis said and get the “Aha!” out of it.
So people took the ‘Aha!’ and it became a quote.
Run enough cycles and the PCR will identify something… yes, something virus, but you can’t be sure what you have.
As a reminder of what we’re discussing, jim2 wrote: “From what I’ve read and watch[ed] so far, I don’t get the idea he thought PCR could NOT be used as a diagnostic test. I haven’t found anywhere he said that explicitly.”
1) What Mullis said seems more like a criticism of high cycle counts that will eventually find Covid in a ham sandwich. (Still not really explicit on Mullis’ part.)
b) Going back to my worry about a positive result that would have prevented my surgery, a positive with a very low cycle count probably would have been good cause to keep me out of the hospital for a while. So I Think, but don’t know, that I was tested with a low cycle count.
iii) Yeah, I’m not convinced Mullis has ever said explicitly that PCR tests can’t be used as a diagnostic test for Covid. I’m sure you looked hard for that, jim2. You can’t prove a negative (“He never said that.”), but you didn’t come up with anything, and that’s something.
Seems a bit gray to me, now.
“AND THE FULLY VACCINATED ROCK OF GIBRALTAR CRUMBLES”
https://richardsonpost.com/howellwoltz/22924/and-the-fully-vaccinated-rock-of-gibraltar-crumbles/
“SO HERE’S A RULE OF THUMB…
If Media hacks, compromised officials, Big Pharma, Big Tech Censors, Globalists and Marxist are all singing in unison—then you know whatever they’re singing about is a damn lie and meant to harm you, so start breaking it apart and examining everything.
If Media exhorts a narrative in unison—you can be sure it’s false.
If these hack leaders try to force it on you—then it’s no good, don’t do it.
If Big Pharma is behind it—it’s not about (or good for) you.
If Big Tech won’t allow questions—then the narrative is fake.
If the Globalists are for it—then it is pure evil.
If the Marxists are in favour of it—then you should fight it to the death.
Let’s prove ‘Cuz’ wrong about us. He thinks we’re stupid and before my next visit with him, I’d like some evidence that he’s wrong.”
So how do they definitively verify a virus? A culture verification process perhaps?
I think of the PCR test as like taking your temperature. If it’s high, you verify why.
I always wondered why the recommended cut off for temp scan lately at the check points was like 100.2+. Why is that? Yeah, we have check points too :-)
I am all for advancement in tech, until it is used for purpose that fit an agenda with no vetting. Setting the cycle counts for this test formally to 40 was not just questionable. All I gotta say.
Fascinating, just sayin. Freshwater Seals?, let alone the other stuff like containing 20% of the worlds fresh water……
https://en.wikipedia.org/wiki/Lake_Baikal
Jim2:
Can you support this claim?
“Only the segment of interest gets replicated, ”
My understanding of DNA cycling is that you open the strands by warming, then opposite sense nucleic acids can hop on the open strand as it cools and make a new strand. ANY strand can replicate this way as long as the “soup” has a supply of nucleic acids in it.
Can you show me where the belief is wrong?
https://bioclimate.commons.gc.cuny.edu/analyzing-dna/pcr/
This implies the “primers” are essential for keeping the process limited to a particular target by keeping the DNA polymerases working only on one DNA segment. But how are these applied to a “sample” of unknown material? Hmmm… :
It looks like that is what makes the PCR TEST different from just rampant PCR….
So I guess the question then becomes how often does a DNA Polymerase latch onto a DNA segment without a “primer”? Is it “perfect”, or more stochastic?
Looks like you can have some floating about in nature for various things:
https://en.wikipedia.org/wiki/Oligonucleotide
So the question would be “what is the ratio of targeted oligonucleotide primer to natural accidental oligonucleotides?” to determining just how likely a false duplication would be. Probably why they said there was a LOT more primer than target…
I would like to thank Jim2 for pushing us to a vetting level process on PCR stuff. It is appreciated and needed. No matter the results, we need to do this type of stuff to prepare for reality.
Just sayin,
next>
Seconding what Ossqss said. I’ve already improved my understanding of the process (those primer things…) and while I’m still of the belief that “run it long enough you will get a positive” even if no target it present (as people who invented it or used it a lot have said so, and the stochastic nature of chemistry + presence of contamination is a given), I’m more comfortable that it is at least moderately targeted in nature.
First thing to understand, here. Infectious diseases may not have specific signs or symptoms. Why? Most of them are generalized damage response and/or immune system activation. So, having a fever does not tell you why the person has a fever. Screening tests, such as PCR, give you a hint; but without knowing true prevalence plus sensitivity and specificity, your hints may be wildly wrong. A diagnostic test, here, would be things like chest x-rays, bronchial washings for culture, microscopic examination of blood, mucus & tissue samples, and the like. So if the health department or the CDC (before it became such a politicized agency back in the late 70s and 80s) reported outbreaks in an area, the local medical people had guidance for their differential diagnoses.
Second thing to understand here is that diagnosis is not gnosis. It is an informed guess, so the first one may be wrong then you go to the second on the list, using responses plus testing to guide the guesses.
“WUHAN’S ‘BAT LADY’ WARNS OF COMING COVID-19 MUTANTS”
https://richardsonpost.com/tyler-durden/22934/wuhans-bat-lady-warning/
The only thing a positive PCR test would be good for is to identify early cases for treatment. As an instrument to trigger quarantine it costs too much for the economy because it triggers ‘cases’ that are not symptomatic or infectious.. As a confirmation for the already symptomatic it has limited utility. The cheap early treatments of suspected cases was always the way to go and to get maximum utility from the test. As it is they wait for serious symptoms before you get any treatment at all. That is plainly and obviously a stupid strategy. And yes, it leads to wild speculation about why. It may NOT be a globalist conspiracy to eliminate useless eaters at all, but it is indistinguishable from that.
For something different
“Saturday Snippet: It’s a hard life, being a prophet”
https://bayourenaissanceman.blogspot.com/2021/08/saturday-snippet-its-hard-life-being.html
@Another Ian:
That Bat Lady link image (her on big screen, adoring crowd staring at it…) is just soooo reminiscent of the Apple Big Brother ad…
A really good page on the Math of testing as it relates to Chinese Wuhan Covid:
http://www.ams.org/publicoutreach/feature-column/fc-2020-09
Other links I followed from it:
https://www.medrxiv.org/content/10.1101/2020.04.24.20078949v1
Specificity is better than I’d expected (though still not 100%) and as stated in the first article:
So rolling out population wide PCR testing, even with a specificity of 98.8%, when the population at large is mostly not infected (as it was at the start of all this and continues to be at any one time) will be “swamped by false positives”…
The thing that this raises for me is that the current mandate to “test once or twice a week” anyone who is not vaccinated in certain populations (such as medical workers) will, for those of use using prophylaxis such as ivermectin, eventually throw a False Positive. IF you have a specificity of 99%, then 1 in 100 tests will be a False Positive (on average). At 2 tests / week, inside one year you will be tagged and bagged, Falsely. Of 100 such staff, on average, one per week will be flagged as POSITIVE!!!! when they are not. This, alone, will create a “Case-demic” among the people so tested.
I guess I need to prepare to be unemployed. As I’m working (occasionally) in a dental office, so will likely be subject to the repeated testing, so will eventually get a False Positive and all that entails.
Then this site finds even lower specificity in actual use:
https://www.infectiousdiseaseadvisor.com/home/topics/covid19/covid-19-diagnosis-pcr-testing-value/
That will be 3 out of 100 False Positives in a prophylaxis group without Covid…
Thanks for the props. It means a lot coming from you guys.
I’m thinking the antibody test will test positive even longer after infection than the RT-PCR test. I guess it’s time to look into cost and time for other, more targeted and certain COVID tests.
I know that as I follow the discussion here on the rt-PCR and the increasingly deep-diving into the fine points of the process/method, and of Kary Mullis’ perspectives, I like to keep these salient context points in mind for myself:
1. The use of the rt-PCR sample manufacturing technique for making medical diagnoses has been disputed/hotly contested for decades, since its early hijacking for use in AIDS/HIV situation.
2. The fact that the use of rt-PCR for SARS-Cov2 is experimental, allowed only under an FDA EUA, fits with the reality of Point 1 and highlights that there is no established technical basis for taking the “test” output at face value.
3. As Kary Mullis died in August 2019, his objections over the years to the diagnostic use of rt-PCR were obviously not relative to SARS-Cov2 application, but the its use in general.
An interesting web site that has an extensive post on the context, as well as details, is a site for a Lyme Disease support group in Wisconsin:
There is interesting interview with a David Crowe, a Canadian researcher. The interview starts well down in the post. The brief item below is from that interview.
….
“PCR is really a manufacturing technique,” Crowe explained. “You start with one molecule. You start with a small amount of DNA and on each cycle the amount doubles, which doesn’t sound like that much, but if you, if you double 30 times, you get approximately a billion times more material than you started with. So as a manufacturing technique, it’s great. What they do is they attach a fluorescent molecule to the RNA as they produce it. You shine a light at one wavelength, and you get a response, you get light sent back at a different wavelength. So, they measure the amount of light that comes back and that’s their surrogate for how much DNA there is. I’m using the word DNA. There’s a step in RT- PCR test which is where you convert the RNA to DNA. So, the PCR test is actually not using the viral RNA. It’s using DNA, but it’s like the complimentary RNA. So logically it’s the same thing, but it can be confusing. Like why am I suddenly talking about DNA? Basically, there’s a certain number of cycles.”
E.M.Smith
About Tor. Nothing really concrete. Just too many incidents. The running out of one of their own under meetoo circumstances, and then this unseemly antagonism toward Richard Stallman (wtf is that any of their business?). I just don’t trust them any more.
Now, don’t get me wrong. I’m certain their targets have checkered pasts. But guess I’m old school about formal charges and a trial by jury. Feel the same way about that cockroach Cuomo. He’s someone I like to hate because he’s incompetent and dangerous. But don’t expect me to get worked up over his cloddish behavior when you haven’t even gone after criminal negligence.
If you’re a woman subjected to abuse from such clowns, I suggest you memorize Dolly Parton’s line: “I’m gonna change you from a rooster to a hen in one shot!” Hell, I’ll even help you pick out a weapon suitable for accomplishing this…..
https://www.fastcompany.com/90618666/mozilla-and-tor-join-calls-to-oust-richard-stallman-from-free-software-foundation
https://www.wired.com/2016/06/tor-developer-jacob-appelbaum-resigns-amid-sex-abuse-claims/
Tor was also sending pink haired tattooed freaks to public libraries in an attempt to garner support for more exit nodes? (meh) Out of touch with real world? What sort of degenerates hire like this? Or is that just the extent of their available labor pool? Move HQ to Kansas !!! :)
Might one extrapolate competence levels from such examples?
@E.M.Smith
On I2P I pretty much just flood fill now. Maybe I’ll eventually develop an appetite for hosting verboten chemical stuff.
In Minecraft :)
I wish ZeroNet supported I2P transport. One of the coolest things you’ll ever witness is an original site going down – but no one notices because everything still keeps running. Only weeks later does everyone learn that “original instigator” had a complete hard drive failure. Now if that isn’t a demonstration of dispersed resilience – don’t know what is.
@ anotherIan, this link well describes how and why the virus will evolve. In short, the vaccine does it. The first few paragraphs are good, but more commonly known, then it gets into, what was to me, new and clearly stated reasons.
https://market-ticker.org/akcs-www?post=243127
And this one is also interesting
https://market-ticker.org/akcs-www?post=242205
Warp Speed” was stupid; it targeted the wrong thing, it has made people specifically vulnerable to nasty outcomes during the month or so before “protection” is allegedly achieved and fails to provide durable protection to the nucleocapsid portion of the virus as it does not target that at all. Further, in roughly 80% of the population as a whole taking the shot is worse than worthless since they are not exposed to severe disease in the first place but the shot is likely to temporarily block the asymptomatic or low-symptom infection that would perfect their natural immunity to the nucleocapsid portion of the virus that is required for replication while exposing said persons to the risk of severe or even fatal side effects by producing a systemic invasion of the spike protein which, if said person was naturally infected, would likely not occur since the person’s immune system can recognize the original infected cells in the respiratory tract and prevent the replication cycle from completing and becoming systemic. And even worse at some point in the future as antibodies wane said persons without nucleocapsid protection are exposed to that risk again but have no idea when that risk has become significant since there’s no reasonable way to know what your antibody titer is over time.
@David A:
I think the idea of Warp Speed was not stupid, but the implementation was. They chose the wrong target (spike). Saw a statement (somewhere now lost to me) by one of the developers saying just that. Sort of a “Woops, the Spike Protein IS the toxin, we made a mistake” statement.
It does bother a little bit when, in every Trump Speech, he touts Warp Speed as his great accomplishment. I suspect he was “played” by the GEBs on that one. IF (and / or when?) ADE hits, it will be a giant fiasco. Right now it’s just a minor fiasco with Vaccine Escape Variants… only time will tell which way it goes from here. If Delta is in fact a “big nothing” but leaves folks with loverly natural immunity, then the Vaccine was an OK deal as it promoted that Variant. IF, however, we get a more lethal variant, ADE, and eventually even a Marek’s Disease like horror show, then it will be seen as the greatest fubar of recent history. Or worse…
I have enough Ivermectin for a prophylactic dose for 250 weeks. 5 years, or 2.5 years if the spouse and I both are doing the full deal. I could stretch it to 5 years for both of us by using 5 ml that matches the FLCCC dosing level but I’m just not sure 100% gets absorbed through the skin and that the pour on dose is directly the same as the oral pill dose, so I’m sticking with the 100 kg sheep dose for now ;-) I figure in 2 to 5 years we ought to know, for certain, and will likely have low side-effects / adverse events vaccines that work better; or know to “not go there”…
Overall, yes, it was a Very Stupid Thing to go whole hog on that instead of sticking with prophylaxis via “all the usual suspects” + zinc + Vit-D. Oh Well. I’m hoping that if it does turn out that the vaccine causes Oh Hell to happen, that those treatments will continue to work OK. But Trump was not a “Medical Man” and so was lead by folks, with M.D. and such after their names, into the more, ahem, “profitable” (for them…) path.
For those wondering who the author on David A’s great links is.
https://en.wikipedia.org/wiki/Karl_Denninger
Beware! It’s my impression that articles rebranded as Yahoo, thus from different original sources, have a short life-time of availability there, so can’t be treated as permalinks. Here’s the original:
https://theconversation.com/the-infantilization-of-western-culture-99556
The The Conversation site seems to be devoted to the U.S. academic establishment, the CDC/WHO medical establishment, and sometimes it’s more partisan than that:
I do tip the proverbial hat to them for having a simple search slot that performs as expected (or considering how useless most “search-this-site” slots still seem to be nowadays, as hoped). I’d typed only “Gottschalk infantilization”,  and might not have needed both words.
But I do resent the mention of computer programming languages as an example for disparagement from overseas:
The final design of the rich (some would say overly complex) programming language Ada was ultimately a French product, as DoD awarded it to Jean Ichbiah’s team and CII-Honeywell Bull.
E.M. if you read both links entirely (the warp speed one, and the one just above it) I think there is a long list of reasons the author chooses the word stupid. Potentially damaging natural immunity is one of many.
Regarding Ivermectin, a question if you will.
I got the paste one, as it was available, and very easy to administer the dosage. 50 pounds a stop on the applicator. And I do take it with food, some fatty foods in my system. Yet the drench most absorb more quickly, systemically, then the paste??
I agree about President Trump. I think he, like the vast majority knew very little about pandemic virology, saw his economic plans, working really well, China brought to the table, India on the rise, etc… and then Covid destroying it all, so he trusted “ the experts “. already his opposition trying to impeach him for breathing, he just wanted to get the economy moving. Unfortunately it very much appears that the experts, were expert political ideologues, and IMV, insane.
David A, IIRC, as was discussed here, the pill form was for human consumption and it appears it is best to distribute inside to outside in the end. Think of the gut level colonization referenced in some of your links. That probably doesn’t happen with a sheep dip. Just sayin.
@David A The link you posted:
https://market-ticker.org/akcs-www?post=242205
has some really good info on natural immunity rates. These two paragraphs are brutal:
“Do you think the Chinese knew all of this up front given that their vaccines are all full-protein inactivated and thus include the nucleocapsid portion? If they deliberately gave us a sequence they knew was directly and singularly pathogenic while ignoring the required nucleocapsid protection for durable protection then Beijing and the CCP must be immediately nuked to ash as they deliberately attempted to kill people worldwide and every single pharma company, US Government agency, “public health” organ and individual who cheered this on and went along with it unquestioned must be completely and irrevocably destroyed.”
“I note that we do not even know if the nucleocapsid portion of the virus, inactivated, is pathogenic. It very well might not be and had we produced inactivated vaccines via that route without the spike protein being present they would likely have a similar risk profile to the seasonal flu shot instead of being 100 or more times as dangerous and at the same time they would have provided durable protection that all of the current shots do not because they omit said nucleocapsid sequences on purpose.”
Some folks reading the Chiefio blog will enjoy the sarcasm herein:
https://www.frontpagemag.com/fpm/2021/05/love-song-bill-and-melinda-daniel-greenfield/:
This story is much more about the arrogance of the Bill and Melinda Gates Foundation, e.g.:
I know it’s not his field, but Greenfield does err in confusing Windows 2000 with the unmentioned Windows Me as among “failed Microsoft project[s]”. His list includes the “Bob” o.s./ user environment (1995), which was led/managed by Melinda herself. Whom I’d call merely “quite attractive” when in her 20s, but hardly a “trophy wife”, unlike D.G.’ assessment.
——–
Note * : Text & symbols enclosed by brackets ‘[’ & ‘]’ are my insertions for clarification.
Let me pose a question to the group.
In the US, we have 36mm cases and 330mm people in the country. I would suppose most of that population has been fully exposed to the virus after 18 months.
We are now garnering more vaxx data on the efficacy and limitations of such, but we now have another wave of infections in virtually every area of vaxx published success rates.
Is the Jab responsible for the variant production? I mean, there is a massive push to put a non-FDA approved item into every single person in the US, on the planet, at this point. Why, when there is obviously substantial natural immunity already in place…….
Just sayin>> sometimes ya feel like your in a fiction novel >
You can search on “ICU full” and find lots of recent articles about ICUs becoming full with COVID patients again. Most say the un-vaxxed are the majority in the hospital, but don’t necessarily give that breakdown for the ICU population.
It makes sense, to me at least, the vax could have produced the Delta variant and others.
An antibody test should be used to determine if one already has immunity. That person could feel OK about skipping the vax immunity-wise. I realize there are other reasons one might not want to be vaxxed no matter what else.
It’s unfortunate there weren’t extensive studies on vit D, zinc, hydroxychloroquine, IVM, and other less exotic defenses or cures very early on. Information like that could have saved a lot of lives. The government has failed us in that regard. It could be simply they thought a vaccine was the right way to go, businesses pushed the science towards a vax, or the government is corrupt and wants to kill us, harm us, or use the pandemic to control us. Or some confluence of the above. I don’t know how much of each we are dealing with, but it sucks no matter what.
No one should be forced to be vaxxed in any case. And no more lock downs or forced mask wearing. A large majority should already have had it or have been vaxxed, but then there’s that nagging problem with ICUs filling up again.
This evening I received an email (shared below) from Davey Alba at the New York Times. Davey explained that “researchers” from two organizations with direct connections to and funding from Facebook were defaming both myself personally and Gab as a whole for spreading “misinformation.”
I’ll get into the baseless and defamatory claims, but first I’d like you to tell you a little more about these two organizations.
Stanford Internet Observatory is led by Alex Stamos who is the former Chief Security Officer for Facebook. The CTO of Stanford Internet Observatory, David Thiel, also worked at Facebook before starting at SIO. Stanford itself is of course widely known as the Ivy League snob school that the “best and brightest” in Silicon Valley all attended and have deep connections to.
The second organization is Graphika. Graphika is a Facebook-funded “research” group whose executive leadership team includes Camille Francois, a woman worked at Google’s infamous censorship technology incubator “Jigsaw,” and Lauren Pencek who previously worked for the National Security Agency (NSA) among others.
The New York Times own reporting confirms that Graphika receives its funding from Facebook and Facebook is also listed as one of Graphika’s top clients right on the front page of their website. Aside from Facebook, Graphika also partners with DARPA, a research and development agency of the United States Department of Defense, along with Google, TikTok, and Pinterest.
Gab will never work with organizations like these and will never subject our community members to the slimy eyeballs of people who wish to “research” them. In fact we have spent years and a considerable amount of our engineering resources to stop these type of “reeeesearchers” from treating our community like lab rats.
Perhaps that’s another reason why Graphika has spent almost an entire year attacking Gab, but I suspect it has more to do with their deep connections to our competitors.
Let’s dive into the email from the New York Times, shall we?
https://news.gab.com/2021/08/06/facebook-funded-researchers-and-the-new-york-times-team-up-to-attack-gab/
@Ossqss – I recall a discussion here, when the ‘vaccines’ were first being given, about the potential to cause a rise in variants. I’m getting a “Wait, I’m not supposed to be surprised by this, am I?” vibe from your post.
I think E.M. had a detailed ‘after some digging’ comment on it and his take was that the ‘vaccine’ might force variants as the bug does its thing in trying to survive. Others added comments to the possibility of the vaccine making things worse, since it didn’t prevent getting WuHuFlu and vaxxed people could still spread the virus.
Anyhow, I just filed away the broad take on the possibility that the ‘leaky vaccine’ would enable variants to emerge. I can’t recall the details. I just put “watch for a bunch of variants” into the memory hopper and moved on.
So now the reports of these variants come as no surprise to me. I’m gathering from your request for input that you are looking for the details again for just how ‘leaky vaccines’ can cause variants to emerge.
You’re remembering correctly on that, but I’m no help to you on details, Back when, there was convincing facts presented here that we should expect to see variants. I thought that was the important thing to remember.
H.R. – EM put up a comment on Marek’s Disease in chickens, where the vaccine they used was “leaky” and thus the virus mutated to one that causes 100% fatality in unvaccinated chickens. Also see the papers from Geert van den Bossche – he’s not only got a pretty impressive CV in producing vaccines but seems to me to have impeccable arguments as to why a leaky vaccine is a bad strategy.
By now there are a few thousand variants known. It’s an RNA virus, so it will mutate quickly. Standard “survival of the fittest” implies that any variant that evades the vaccines will get passed on to someone else because the person who’s unlucky to generate that variant will produce a lot of it because the vaccinated immune system will destroy the variants it knows.
Thing is that the vaccines produce blood antibodies, so allow the virus to multiply in the airways and mucosal membranes. Thus a vaccinated person can be both infected and infectious even with a variant that the vaccine does control, but they won’t get that sick because if it gets into the bloodstream it’s destroyed.
Having said that, I’m relying on natural immunity and being in the sun a lot with a bit of help from tonic water, given that IVM isn’t available here. At the moment, sore throat so I’ve got infected again with maybe a different variant than I had in March. Then again, visitors from Germany here at the moment, so some sort of infection might be expected. I’ll be heading out in the sun shortly for a bit of summer pruning. Should fix my problems.
A nice little quote I picked up from somewhere: “experts – often wrong, but never uncertain”.
On the Vaccine Tyranny thread I posted a question if anyone knows why Mexico’s cases and deaths are heading back up very quickly despite them controlling COVID with Ivermectin.
Any ideas?
@AC Osborn: From other thread: “Anybody got any idea why Mexico, who tamed COVID with Ivermectin are now almost back where they were in the number of cases.
Even the number of deaths has quadrupled.
Has Ivermectin stopped working, didn’t really work first time around or have they stopped uisng it?”
Really good question! I don’t know the answer, but some more possibilities come to mind in addition.
1) Death numbers are inflated
2) Earlier death numbers were deflated (ie Ivermectin never worked in the first place)
3) Ivermectin has stopped working
4) Ivermectin is not being used
5) Ivermectin is ineffective against some current variant
6) Vaxxed individuals do not respond to Ivermectin
7) Vaxxed individuals suffering side effects which are being ascribed to having a viral infection
8) New variant targets unvaxxed more aggressively than original virus
9) New variant targets vaxxed more aggressively than original virus
10) Definition of “cases” has been redefined again
I am sure there are more possibilities but those come quickly to mind. It seems to me that the first bits of info needed are
1) Is the data correct? Is the data still measuring the same characteristics as before?
2) What is the percentage of vaxxed cases and unvaxxed cases? What is the general non-case ratio of vaxxed to unvaxxed?
I don’t think we can know what influence Ivermectin has unless we first know (with confidence) those basic numbers.
@David A:
As I said: The idea of Warp Speed (making a SAFE and EFFECTIVE vaccine as quickly as humanly possible) was a good one. The manner in which it was done, and the resulting product, clearly are “stupid”.
Per Ivermectin Pour On:
You are supposed to allow 8+ hours for it to “soak in” before washing the skin where applied. The digestive tract is faster, I think. As it is a “once a week” dose schedule with fairly good persistence, speed likely isn’t all that important.
@Ossqss:
I can’t put up a full defense of the position, but my conclusion is that there are two things happening at once:
1) Vaccine Escape creates new variations that are both able to bypass the vaccine antibodies (i.e. infect the vaccinated) and infect those not vaccinated. (Unknown if it can infect those with natural immunity or, if it does, if the rate is a lot lower… or not.)
2) Vaccinating an un-vaccinated person damages their existing antibodies in favor of spike antibodies that don’t work as well (a known problem with repeated vaccinations is the tendency for poorer response over time). Basically your body “focuses” resources more on the most recent and most damaging antigens, not on the most strategically beneficial target…
In short, the push to “vaccinate everyone” with a KNOWN FAILED LEAKY vaccine is creating the new pandemic waves. Evidence? Sweden vs Israel comes to mind… but look at any highly vaccinated country vs the non. Same pattern.
@Jim2:
There’s a HUGE data quality problem with the “ICU Full Again” narrative. On the radio today they were talking about some M.D. in Florida moaning and complaining about the FULL ICU and Horrible FATIGUE of Doctors and all with the massive wave of the children getting Covid and being HOSPITALIZED!!!! OH THE AGONY!!!!
Problem is that there’s something like 173 kids hospitalized with it, and Florida has something like 187 hospitals. LESS than ONE per Hospital… I.e. the story is smoke and mirrors.
How much of the rest of the Narrative is the same, eh?
BTW, story was supposedly picked up by NTY who ran with it as God’s Own Truth that there’s a massive wave of infected kids in Florida. Despite it being a pack of lies. Several MILLIONS of kids, a hundred+ sick. How many of them have leukemia or immune problems or other comorbidities, eh?
@Simon Derricutt:
Look around for Quercetin. The Zalenko Protocol is basically it, with Vit-D, C, and Zinc. I posted a link in another thread. Ought to be OTC from health food stores. 500 mg / day for low risk prophylaxis, 1 gm / day for treatments.
https://vladimirzelenkomd.com/zelenko-prophylaxis-protocol/
@AC Osborn:
The story is that in “some States” some government “authorities” banned ivermectin, and cases in those States are now rising again.
Same thing happened in Indonesia. Numbers plummeting as a rich benefactor paid for a boat load of ivermectin. Government “took the program over” and stopped handing out the ivermectin. Cases now rising rapidly.
That these kinds of events are then being held up as evidence for failure of ivermectin is evil.
Last time I will post this, but if missed I highly encourage reading it if you missed it.
https://market-ticker.org/akcs-www?post=243127
This as well. https://market-ticker.org/akcs-www?post=242430
For corona viruses, in the tropics and subtropics, the epidemic season (northern hemisphere) is now, summer. To the extent true prevalence is increasing or has increased in Mexico, I would expect true cases to increase as well. I’d also expect it along the southern tier of US states (along or near 35 degrees N at most), whether they border Mexico or not. That said border is wide open exacerbates the situation.
“According to the CDC, the number of covid patient in-hospital deaths in May was 15% among the vaccinated, not 0.5 percent as they all claimed — a figure that is 30 TIMES more than they claimed.”
https://en-volve.com/2021/08/09/cdc-director-admits-they-lied-about-covid-deaths-among-vaccinated-they-are-30-times-higher/
Via Jo Nova
EM – I also have a stock of green tea…. However, turned out as one bad (sweaty and sleepless) night and a residual sore throat that is easing up. Possibly helped along by a somewhat large dose of anthocyanin in the form of around a bottle of red wine during the bbq. Somewhat of a score for having an immune system not modified by the current vax, and of course having the opportunity to spend enough time in the sunshine to get a high natural dose of vitamin D. The fruit trees have a surprisingly large crop this year, so vitamin C is also natural rather than pills.
I wouldn’t have called myself anti-vax. They have done an amazing job at reducing illness, and though they are not risk-free the risks of the vaccines are mostly a lot lower than risks from the disease itself. It just that with the Corona vaccines the strategy is wrong, and the risks from the vaccine are thus higher and the pay-back is smaller, and since the vaccine is leaky there’s a much higher risk of producing variants that escape the vaccine and thus generating further waves. The science bit is clever, but it’s not clever to do that with an RNA virus that mutates often.
If you can’t guarantee 100% eradication, then those that survive will be resistant to your fix and will multiply until they are the major threat. Pretty standard Darwinism. Also, with the vax, it only kills the virus that gets into the bloodstream, but of course where it enters (and multiplies) is the airways and mucous membranes so that’s where you need the antibodies, and they aren’t there. Who specified such a poor vaccine specification?
“After 2020, you expected an honest election???:”
https://bayourenaissanceman.blogspot.com/2021/08/after-2020-you-expected-honest-election.html
Reddit
For the record
The video linked in this comment
“mark stevens
August 10, 2021 10:26 am”
at
And further down in comments there – more duck shoving
“Mike Maguire
August 10, 2021 10:26 am
Great topic.
I’ve been using that AP story from 1989 for the last decade to show the exact same thing.
However, what people may not realize is that 1989 story was changed to try to hide it. They got rid of the year and got rid of the title earlier this year.
I discus it more here:
https://www.marketforum.com/forum/topic/70534/
“Correct and they’ve been saying it constantly since the late 1980’s…..but there’s been a change in one of the earliest articles of the United Nations stating this below. What is it?”
U.N. Predicts Disaster if Global Warming Not CheckedPETER JAMES SPIELMANN June 29, 1989:
https://apnews.com/article/bd45c372caf118ec99964ea547880cd0 ”
And more
Another one
“betapug
August 10, 2021 1:35 pm
“Brown suggested that compensating Brazil, Indonesia and Kenya for preserving rain forests may be necessary.” looks supremely ironic in view of NASA’s 2019 startling admission that they were wrong, tropical rainforests are actually major sources of CO2, not sinks.
Five years of analyzing data from the OCO2 satellite (launched with great fanfare “to pinpoint the sources of CO2”) seems to now reveal the reason it was suddenly disappeared from public view:
“For as long as we can remember, we’ve talked about Earth’s tropical rainforests as the ‘lungs’ of our planet,” …But that’s not what’s being borne out by our data. We’re seeing that Earth’s tropical regions are a net source of carbon dioxide to the atmosphere, at least since 2009. This changes our understanding of things.”
https://climate.nasa.gov/news/2915/the-atmosphere-getting-a-handle-on-carbon-dioxide/
The admission that “scientists” were completely wrong is a welcome addition to the evidence that “Science” like “Climate” is a dynamic process, not an authorized canon. Unfortunately new discoveries or insights are unlikely to change policy because reality does not drive policy.
In the words of former EU Climate Commissioner Connie Hedegaard,
“Let’s say that science, some decades from now, said ‘we were wrong, it was not about climate’, would it not in any case have been good to do many of things you have to do in order to combat climate change?.”
And for something different
“Learn A Second Language: Bidenese”
http://www.smalldeadanimals.com/2021/08/10/learn-a-second-language-bidenese/
Re those flying cars
Just when you thought you’d seen everything:
Archaeologists find the legendary Trojan Horse! Previously considered to be a mythical construction by many, it now appears this was the real deal.
https://greekreporter.com/2021/08/10/archaeologists-discover-trojan-horse-in-turkey/
@Another Ian:
Rain Forests were in dynamic equilibrium. Then people started to cut them down and burn them. In NO case is that a carbon sink. One is neutral, the other is a net source of CO2. This was obvious from the start.
Start from the assumption that anything a “Climate Apostle” says is a lie, and you will be much closer to actual truth and reality.
Per “Billy Bob”: As they say “nice try”. Though I kind of saw it coming from his take off roll. I was thinking “long roll, low rate of climb, how can he turn that thing to get back to the field?”… and then his climb out is too short, his post lift off run to obstacle too short, and he can’t seem to turn well or at all. Anyone with even minimal aviation experience would not have tried that without a LONG open dirt area in front for a landing…
@Chris in C:
Nice! I hope it proves out.
@Chris in C
It would be amazing if “old world recycling” missed a pile of sticks like that!
Variants analysed
Pingback: W.O.O.D. – 11 August 2021 | Musings from the Chiefio
“The IPCC AR6 Hockeystick”
Steve McIntyre
Here’s a Covid drug that may be a surefire winner. It apparently works by stopping cytokine storms.
https://www.jpost.com/health-science/covid-90-percent-of-patients-treated-with-new-israeli-drug-discharged-in-5-days-675961
Here ya go, he has many points, and I will be buying the book >
Terrific visual presentation of madness of crowds menticide and behavioural conditioning to create a pervasive atmosphere of terror in those you seek to control…